ID: 914205023 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:145519231-145519253 |
Sequence | CTGAATGAGCTTTTGGTAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
914205017_914205023 | 11 | Left | 914205017 | 1:145519197-145519219 | CCCTTGAAGTTGTTAGACATTCA | No data | ||
Right | 914205023 | 1:145519231-145519253 | CTGAATGAGCTTTTGGTAGAGGG | No data | ||||
914205018_914205023 | 10 | Left | 914205018 | 1:145519198-145519220 | CCTTGAAGTTGTTAGACATTCAG | No data | ||
Right | 914205023 | 1:145519231-145519253 | CTGAATGAGCTTTTGGTAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
914205023 | Original CRISPR | CTGAATGAGCTTTTGGTAGA GGG | Intergenic | ||
No off target data available for this crispr |