ID: 914205023

View in Genome Browser
Species Human (GRCh38)
Location 1:145519231-145519253
Sequence CTGAATGAGCTTTTGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914205017_914205023 11 Left 914205017 1:145519197-145519219 CCCTTGAAGTTGTTAGACATTCA No data
Right 914205023 1:145519231-145519253 CTGAATGAGCTTTTGGTAGAGGG No data
914205018_914205023 10 Left 914205018 1:145519198-145519220 CCTTGAAGTTGTTAGACATTCAG No data
Right 914205023 1:145519231-145519253 CTGAATGAGCTTTTGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914205023 Original CRISPR CTGAATGAGCTTTTGGTAGA GGG Intergenic
No off target data available for this crispr