ID: 914207039

View in Genome Browser
Species Human (GRCh38)
Location 1:145541237-145541259
Sequence GGCTCACGTCCTTCTCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914207039_914207049 10 Left 914207039 1:145541237-145541259 CCTGTAGGAGAAGGACGTGAGCC No data
Right 914207049 1:145541270-145541292 GGAGTGGGCACTGAGGATTATGG No data
914207039_914207046 -5 Left 914207039 1:145541237-145541259 CCTGTAGGAGAAGGACGTGAGCC No data
Right 914207046 1:145541255-145541277 GAGCCGGATGGGGTAGGAGTGGG No data
914207039_914207048 3 Left 914207039 1:145541237-145541259 CCTGTAGGAGAAGGACGTGAGCC No data
Right 914207048 1:145541263-145541285 TGGGGTAGGAGTGGGCACTGAGG No data
914207039_914207045 -6 Left 914207039 1:145541237-145541259 CCTGTAGGAGAAGGACGTGAGCC No data
Right 914207045 1:145541254-145541276 TGAGCCGGATGGGGTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914207039 Original CRISPR GGCTCACGTCCTTCTCCTAC AGG (reversed) Intergenic
No off target data available for this crispr