ID: 914207045

View in Genome Browser
Species Human (GRCh38)
Location 1:145541254-145541276
Sequence TGAGCCGGATGGGGTAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914207039_914207045 -6 Left 914207039 1:145541237-145541259 CCTGTAGGAGAAGGACGTGAGCC No data
Right 914207045 1:145541254-145541276 TGAGCCGGATGGGGTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914207045 Original CRISPR TGAGCCGGATGGGGTAGGAG TGG Intergenic
No off target data available for this crispr