ID: 914207048

View in Genome Browser
Species Human (GRCh38)
Location 1:145541263-145541285
Sequence TGGGGTAGGAGTGGGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914207039_914207048 3 Left 914207039 1:145541237-145541259 CCTGTAGGAGAAGGACGTGAGCC No data
Right 914207048 1:145541263-145541285 TGGGGTAGGAGTGGGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914207048 Original CRISPR TGGGGTAGGAGTGGGCACTG AGG Intergenic
No off target data available for this crispr