ID: 914207375

View in Genome Browser
Species Human (GRCh38)
Location 1:145544628-145544650
Sequence TTCTCTTAGACTGTACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914207370_914207375 7 Left 914207370 1:145544598-145544620 CCAACACCTGAACGAGCAGGGAA No data
Right 914207375 1:145544628-145544650 TTCTCTTAGACTGTACAGGAAGG No data
914207367_914207375 27 Left 914207367 1:145544578-145544600 CCACATGGAACTGAATTCTGCCA 0: 7
1: 81
2: 189
3: 364
4: 703
Right 914207375 1:145544628-145544650 TTCTCTTAGACTGTACAGGAAGG No data
914207373_914207375 1 Left 914207373 1:145544604-145544626 CCTGAACGAGCAGGGAAAGGGAT No data
Right 914207375 1:145544628-145544650 TTCTCTTAGACTGTACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914207375 Original CRISPR TTCTCTTAGACTGTACAGGA AGG Intergenic
No off target data available for this crispr