ID: 914211403

View in Genome Browser
Species Human (GRCh38)
Location 1:145582701-145582723
Sequence CACCTGTGAATAAGAACATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914211399_914211403 9 Left 914211399 1:145582669-145582691 CCTGTGTCCATGTGTTCTCATTG 0: 14827
1: 17946
2: 7623
3: 2542
4: 1114
Right 914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG No data
914211396_914211403 15 Left 914211396 1:145582663-145582685 CCCCTTCCTGTGTCCATGTGTTC 0: 10230
1: 15763
2: 8550
3: 7109
4: 5481
Right 914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG No data
914211400_914211403 2 Left 914211400 1:145582676-145582698 CCATGTGTTCTCATTGTTCAATT 0: 9354
1: 17675
2: 11214
3: 5424
4: 3545
Right 914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG No data
914211395_914211403 30 Left 914211395 1:145582648-145582670 CCAGTGTGTGATGTTCCCCTTCC 0: 5528
1: 11756
2: 10873
3: 5183
4: 3568
Right 914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG No data
914211398_914211403 13 Left 914211398 1:145582665-145582687 CCTTCCTGTGTCCATGTGTTCTC 0: 10328
1: 16372
2: 10329
3: 6495
4: 4392
Right 914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG No data
914211397_914211403 14 Left 914211397 1:145582664-145582686 CCCTTCCTGTGTCCATGTGTTCT 0: 10428
1: 16262
2: 8854
3: 7699
4: 6014
Right 914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914211403 Original CRISPR CACCTGTGAATAAGAACATG CGG Intergenic
No off target data available for this crispr