ID: 914221846

View in Genome Browser
Species Human (GRCh38)
Location 1:145688624-145688646
Sequence TAGTAGAAGCTTGGTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914221841_914221846 11 Left 914221841 1:145688590-145688612 CCTGAAGGAATGACACTTCCAAG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 914221846 1:145688624-145688646 TAGTAGAAGCTTGGTGAGGTAGG No data
914221843_914221846 -7 Left 914221843 1:145688608-145688630 CCAAGAACTGAAGGATTAGTAGA 0: 1
1: 0
2: 0
3: 24
4: 195
Right 914221846 1:145688624-145688646 TAGTAGAAGCTTGGTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914221846 Original CRISPR TAGTAGAAGCTTGGTGAGGT AGG Intronic
No off target data available for this crispr