ID: 914221846 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:145688624-145688646 |
| Sequence | TAGTAGAAGCTTGGTGAGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914221841_914221846 | 11 | Left | 914221841 | 1:145688590-145688612 | CCTGAAGGAATGACACTTCCAAG | 0: 1 1: 0 2: 1 3: 15 4: 150 |
||
| Right | 914221846 | 1:145688624-145688646 | TAGTAGAAGCTTGGTGAGGTAGG | No data | ||||
| 914221843_914221846 | -7 | Left | 914221843 | 1:145688608-145688630 | CCAAGAACTGAAGGATTAGTAGA | 0: 1 1: 0 2: 0 3: 24 4: 195 |
||
| Right | 914221846 | 1:145688624-145688646 | TAGTAGAAGCTTGGTGAGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914221846 | Original CRISPR | TAGTAGAAGCTTGGTGAGGT AGG | Intronic | ||
| No off target data available for this crispr | |||||