ID: 914224252

View in Genome Browser
Species Human (GRCh38)
Location 1:145707304-145707326
Sequence GAGCAGTTCTTACCTGGAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 329}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914224246_914224252 6 Left 914224246 1:145707275-145707297 CCGGTGGCCAGCACCCTCAAGGA 0: 1
1: 0
2: 1
3: 16
4: 227
Right 914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 329
914224249_914224252 -7 Left 914224249 1:145707288-145707310 CCCTCAAGGAGGACACGAGCAGT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 329
914224248_914224252 -1 Left 914224248 1:145707282-145707304 CCAGCACCCTCAAGGAGGACACG 0: 1
1: 0
2: 0
3: 16
4: 246
Right 914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 329
914224250_914224252 -8 Left 914224250 1:145707289-145707311 CCTCAAGGAGGACACGAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 78
Right 914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 329
914224243_914224252 8 Left 914224243 1:145707273-145707295 CCCCGGTGGCCAGCACCCTCAAG 0: 1
1: 0
2: 3
3: 11
4: 158
Right 914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 329
914224244_914224252 7 Left 914224244 1:145707274-145707296 CCCGGTGGCCAGCACCCTCAAGG 0: 1
1: 0
2: 2
3: 22
4: 225
Right 914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914224252 Original CRISPR GAGCAGTTCTTACCTGGAGA TGG Exonic
900072505 1:783195-783217 GAACAGTTCTGGCCTGGAGTAGG + Intergenic
901806012 1:11738993-11739015 GAGGAAGTCTAACCTGGAGAAGG - Intronic
904571892 1:31472524-31472546 AAGCACTTCTTACATGGCGACGG + Intergenic
907246844 1:53114205-53114227 CTGCAGTGCTTCCCTGGAGAGGG + Intronic
908568848 1:65387467-65387489 GATCAGTGGTTACCAGGAGATGG - Intronic
910589862 1:88919029-88919051 TAGCAGTTGTCACCTGGACAGGG - Intergenic
913066486 1:115260698-115260720 AAGCAGTTAATACCTGGAGGGGG + Intergenic
914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG + Exonic
916487901 1:165275655-165275677 CAGCTCTTCTTCCCTGGAGAAGG - Intronic
916491932 1:165309552-165309574 GGGCAGATCTTGGCTGGAGATGG - Intronic
916657656 1:166891368-166891390 AAGCAGTTCTCAACTGAAGATGG + Intergenic
918839585 1:189516808-189516830 GAGAAGTTTTTAACTTGAGAAGG - Intergenic
923632718 1:235663971-235663993 GAGAAGATCTTACCTGATGATGG + Exonic
924033052 1:239906922-239906944 GAGCAATGCCAACCTGGAGAAGG - Intronic
1063714157 10:8510805-8510827 GAACAGTGCCTACCTGGAAAAGG - Intergenic
1065265426 10:23970458-23970480 GAGCAGTGGTTACCAGGAGCTGG + Intronic
1065441802 10:25760459-25760481 GGGCAGTTGTTAGCTGGAGCTGG - Intergenic
1065445774 10:25796824-25796846 GAGAAGGTCTTTGCTGGAGAGGG - Intergenic
1066276414 10:33872836-33872858 GAGCTATTCTTCCCAGGAGACGG + Intergenic
1066665644 10:37780569-37780591 GAGGAGTCCTCACCTGTAGAGGG - Intronic
1069598000 10:69685109-69685131 CAGCACTTCTCACCTGGAGAGGG - Exonic
1071334768 10:84591494-84591516 GAGCAGTTGTCACCTTGTGAAGG + Intergenic
1071826208 10:89328824-89328846 GATCAGTGGTTGCCTGGAGATGG + Intronic
1075485327 10:122817789-122817811 GATCAGTGTTTGCCTGGAGAAGG - Intergenic
1075491424 10:122873764-122873786 GAGCAGTGCTTACAGGGAAACGG - Intronic
1075675731 10:124294528-124294550 CAGCAGTTCTTTCCGGGGGAAGG - Intergenic
1076138670 10:128062875-128062897 GAGGAGTTCCTAGCTGGAGTGGG + Intronic
1076209811 10:128631280-128631302 GTGCATTTCTTACCTGGGCAAGG + Intergenic
1079121057 11:17685330-17685352 AAGCAGCTCTTAACTAGAGAAGG - Intergenic
1079136230 11:17777268-17777290 CTGCAGTTCTTGCCTGGGGAGGG - Intronic
1079357417 11:19741434-19741456 GAACAGTTGTTACCTGAAGTGGG - Intronic
1079542376 11:21591940-21591962 GACCAGTTCTTACCTCTAGATGG + Intergenic
1080295474 11:30722258-30722280 GATCAGTGCTTACTTGGAGCCGG - Intergenic
1081596765 11:44464668-44464690 GAGCAGTAAATTCCTGGAGATGG - Intergenic
1083020503 11:59502354-59502376 GATCAGTTGTTGCCTGAAGAAGG + Intergenic
1083333598 11:61910580-61910602 GAGCAGTCCTGACCTGGTGCTGG + Intronic
1085276515 11:75303586-75303608 GGGCTGTTTTTACCTGCAGAAGG + Intronic
1085577457 11:77619786-77619808 AAGCAATTCTTACCAGCAGAGGG - Intronic
1085661412 11:78370807-78370829 GAGCAGTTGGAAGCTGGAGAAGG - Intronic
1086455540 11:86955703-86955725 GCGCACTTCTCACCTGCAGAAGG - Intergenic
1087131623 11:94673785-94673807 GAGGGGTTCCTACCTGGACAGGG - Intergenic
1087160376 11:94942788-94942810 GGGCAGTCATTTCCTGGAGAAGG + Intergenic
1089182462 11:116592537-116592559 GAGAACTTCTGACTTGGAGAAGG - Intergenic
1091143033 11:133252496-133252518 CTGCAGTGCTTAGCTGGAGATGG + Intronic
1091744739 12:2983904-2983926 GACCAGTCCTTACTGGGAGATGG + Intronic
1095893700 12:47259077-47259099 GAGCAGCTTTCACCTGGAAAAGG - Intergenic
1096435681 12:51589941-51589963 GATCAGTGGTTGCCTGGAGAGGG + Intergenic
1098618401 12:72558792-72558814 GAGAAGGTCTTCACTGGAGAAGG + Intronic
1099061186 12:77911191-77911213 GATCACTTTTTACCTGGAGTTGG - Intronic
1099268077 12:80473375-80473397 GAGCAGTTTTTAGGTGGAGATGG - Intronic
1099779959 12:87182152-87182174 AAGCACTTCTTACATGGTGATGG - Intergenic
1100686439 12:96991699-96991721 GAGTAGTTATGAGCTGGAGAGGG + Intergenic
1103313749 12:120034459-120034481 GGGCAGTTAATCCCTGGAGAGGG + Intronic
1107092754 13:36500110-36500132 GAGCAGTTGTTGCCTGAGGATGG - Intergenic
1107356335 13:39571507-39571529 AAACAGTTCTCAGCTGGAGAGGG - Intronic
1108176068 13:47794158-47794180 GGGCAGTTCTCACCTAGAAATGG - Intergenic
1113790738 13:113026719-113026741 GGTCAGTTCTTTCCTGGAAAGGG - Intronic
1114563938 14:23614444-23614466 GAGCTGTACTCACCTGGTGAGGG + Intergenic
1114623904 14:24115926-24115948 GAGTGGTTCTTACCTAGGGAGGG + Intronic
1116556440 14:46316197-46316219 GGGCAGTTCATTCTTGGAGATGG - Intergenic
1117056006 14:51912528-51912550 GAGGAGTTTTGTCCTGGAGATGG - Intronic
1122010884 14:98745923-98745945 CAGCAGTTGTTTCCTGGGGAGGG + Intergenic
1123138963 14:106056465-106056487 GTCCAATTCTTACCTGGAGTTGG - Intergenic
1128612345 15:69084236-69084258 GAGCAGTTCTGACATGGTGGGGG - Intergenic
1129066183 15:72906158-72906180 GTACAGTTCTTACCTGGTGGTGG - Intergenic
1129236420 15:74226311-74226333 GAGCAGTTATGACTTGGAGCAGG + Intergenic
1129338601 15:74869980-74870002 GGGCAGCTCTGACCAGGAGAAGG + Intronic
1131993761 15:98114754-98114776 AAGCTGTTTCTACCTGGAGAAGG + Intergenic
1133791426 16:9012489-9012511 GAGGACTTCTGACCTGAAGAAGG - Intergenic
1133937687 16:10282375-10282397 GGGCAGTTCTTACATGGAAGTGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1135006932 16:18833765-18833787 GATCAGTGTTTACTTGGAGATGG - Intronic
1136186867 16:28593441-28593463 GAGAAGTTCATGGCTGGAGAAGG - Exonic
1138475012 16:57265366-57265388 ACCCAGTTCTCACCTGGAGAAGG - Intronic
1139652032 16:68367197-68367219 GAGCAGTTGTTGCCTGAAGACGG - Intronic
1143048717 17:4104256-4104278 GAGTAGTTCTTACCTGTTGGAGG - Intronic
1143069163 17:4276044-4276066 GAGCAGTACTTACCAGGGCAAGG - Intronic
1144201126 17:12943674-12943696 GTGCAGGCCTTCCCTGGAGAAGG + Intronic
1145418630 17:22746945-22746967 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145418805 17:22749324-22749346 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145418972 17:22751700-22751722 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145419137 17:22754079-22754101 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145419309 17:22756458-22756480 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145419483 17:22758836-22758858 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145419654 17:22761215-22761237 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145419819 17:22763592-22763614 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145420150 17:22818170-22818192 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145420402 17:22821743-22821765 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145420573 17:22824122-22824144 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145420746 17:22826502-22826524 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145420917 17:22828881-22828903 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145421089 17:22831259-22831281 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145421439 17:22836018-22836040 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145421614 17:22838397-22838419 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145421791 17:22840776-22840798 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145422133 17:22845534-22845556 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145422312 17:22847913-22847935 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145422486 17:22850292-22850314 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145423181 17:22859807-22859829 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145423527 17:22864565-22864587 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145423702 17:22866944-22866966 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145423871 17:22869323-22869345 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145424042 17:22871702-22871724 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145424209 17:22874081-22874103 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145424383 17:22876460-22876482 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145424562 17:22878839-22878861 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145424740 17:22881218-22881240 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145424911 17:22883597-22883619 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145425080 17:22885976-22885998 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145425421 17:22890734-22890756 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145425597 17:22893113-22893135 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145425767 17:22895491-22895513 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145425941 17:22897869-22897891 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145426111 17:22900248-22900270 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145426459 17:22905006-22905028 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145426629 17:22907384-22907406 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145426795 17:22909764-22909786 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145426967 17:22912143-22912165 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145427133 17:22914525-22914547 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145427303 17:22916904-22916926 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145427475 17:22919283-22919305 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145427649 17:22921663-22921685 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145427822 17:22924041-22924063 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145427993 17:22926420-22926442 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145428685 17:22935937-22935959 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145428857 17:22938317-22938339 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145429032 17:22940697-22940719 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145429203 17:22943076-22943098 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145429379 17:22945455-22945477 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145429546 17:22947834-22947856 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145429895 17:22952591-22952613 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145430240 17:22957348-22957370 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145430414 17:22959728-22959750 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145430766 17:22964487-22964509 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145430938 17:22966869-22966891 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145431114 17:22969248-22969270 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145431807 17:22978767-22978789 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145431982 17:22981146-22981168 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145432156 17:22983526-22983548 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145432499 17:22988287-22988309 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145432673 17:22990669-22990691 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145432850 17:22993051-22993073 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145433020 17:22995430-22995452 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145433194 17:22997809-22997831 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145433446 17:23001366-23001388 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145433619 17:23003745-23003767 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145433795 17:23006125-23006147 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145433970 17:23008504-23008526 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145434145 17:23010884-23010906 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145434324 17:23013264-23013286 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145434497 17:23015643-23015665 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145434841 17:23020402-23020424 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145435182 17:23025161-23025183 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145435523 17:23029920-23029942 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145435693 17:23032299-23032321 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145435859 17:23034678-23034700 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145436204 17:23039436-23039458 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145436378 17:23041817-23041839 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145436554 17:23044196-23044218 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145436718 17:23046576-23046598 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145437061 17:23051335-23051357 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145437236 17:23053716-23053738 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145437409 17:23056095-23056117 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145437588 17:23058474-23058496 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145437760 17:23060853-23060875 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145437929 17:23063230-23063252 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145438099 17:23065609-23065631 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145438268 17:23067988-23068010 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145438609 17:23072747-23072769 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145438781 17:23075128-23075150 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145438952 17:23077511-23077533 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145439123 17:23079890-23079912 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145439290 17:23082269-23082291 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145439458 17:23084648-23084670 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145439632 17:23087027-23087049 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145439885 17:23090598-23090620 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145440395 17:23097733-23097755 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145440571 17:23100113-23100135 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145440744 17:23102494-23102516 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145440916 17:23104873-23104895 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145441261 17:23109631-23109653 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145441437 17:23112013-23112035 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145441612 17:23114392-23114414 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145441783 17:23116772-23116794 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145442136 17:23121532-23121554 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145442310 17:23123911-23123933 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145442484 17:23126291-23126313 GAGCAGTCCTTTCCTTGGGATGG + Intergenic
1145442654 17:23128672-23128694 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145443244 17:23137007-23137029 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145443590 17:23141765-23141787 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145443934 17:23146525-23146547 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145444284 17:23151284-23151306 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145444460 17:23153665-23153687 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145444633 17:23156044-23156066 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145444986 17:23160803-23160825 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145445683 17:23170322-23170344 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145445857 17:23172703-23172725 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145446026 17:23175082-23175104 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145446196 17:23177461-23177483 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145446377 17:23179840-23179862 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145446545 17:23182219-23182241 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145447057 17:23189355-23189377 GAGCAGTACTTTCCTTGGGATGG + Intergenic
1145718453 17:27045874-27045896 GAGAACTTCTGACCTGGAGGTGG + Intergenic
1145758059 17:27407296-27407318 CAGGAGGTCTTACCAGGAGATGG + Intergenic
1147630260 17:41925741-41925763 AGGCAGTAGTTACCTGGAGAGGG + Intronic
1148943590 17:51238065-51238087 GATCAGTAATTACCTGGGGATGG + Intronic
1151185726 17:72362700-72362722 GAGCACTGCTTCCCTGGAGTAGG + Intergenic
1151737797 17:75955815-75955837 GAACAGTTCTTACCTGGCAAAGG + Exonic
1152525662 17:80887026-80887048 GGGCAGCTCTTACCTGGTTATGG + Intronic
1152557560 17:81061439-81061461 GATCAGTGGTTGCCTGGAGATGG - Intronic
1153254047 18:3152545-3152567 CAGCAGTTGGTACCTGGGGATGG + Intronic
1153254234 18:3154548-3154570 CAGCAGTTAGTACCTGCAGATGG - Intronic
1153486018 18:5598959-5598981 GAACAGTGATTAACTGGAGAAGG + Intronic
1156439595 18:37170923-37170945 GAGCAGTTATTACCTACAAATGG + Intronic
1157084690 18:44567542-44567564 TAGCAGTGCTTACCTACAGATGG + Intergenic
1157597450 18:48872403-48872425 GAGTCGTTAATACCTGGAGAGGG + Intergenic
1157738313 18:50070400-50070422 GAGCAGTTCTCATCTGGGGTGGG + Intronic
1159004529 18:63000827-63000849 CAGCAGTGCTTACCTGGATGGGG - Intergenic
1159447565 18:68559264-68559286 GAGAAGGGCTGACCTGGAGATGG - Intergenic
1159690515 18:71482357-71482379 GAGTAGTTCTCATCTGAAGAAGG - Intergenic
1161469136 19:4447690-4447712 GAGCTGCTGTTACCTGGAGCAGG - Intronic
1161726138 19:5930149-5930171 GTGCAGTTCTGAGTTGGAGAAGG - Intronic
1164291171 19:23869925-23869947 GAGTATTGCTTACCTGGAGCTGG - Intergenic
1167216486 19:48169203-48169225 GAGGAGTTCTTATGTGGAGAGGG + Intronic
1167311779 19:48741179-48741201 GAGCAGGACTTTCCTGGGGATGG - Intronic
1167815110 19:51873471-51873493 AAGCTGTGCTTTCCTGGAGAAGG + Exonic
926359898 2:12077067-12077089 GAGCATTTGTTACCTGGAAGAGG - Intergenic
926370535 2:12174382-12174404 GAGCAGTACTAACCTTGAGGGGG - Intergenic
929088623 2:38193153-38193175 GCGCAGTTCTTGCTTGGTGAAGG + Intergenic
929564048 2:42973902-42973924 GAGTGGCTCTTCCCTGGAGAAGG + Intergenic
932311782 2:70748538-70748560 GAGCACTTCCTACCTGGGAATGG + Intronic
932426974 2:71644024-71644046 GTGCGGCTCCTACCTGGAGAAGG + Exonic
933617403 2:84496876-84496898 GATCAGTTATTACCTGGGGCTGG - Intergenic
933770686 2:85742031-85742053 GAGCAGCTCTTATTTTGAGAAGG + Intergenic
934521174 2:95021105-95021127 GAGCAGTGGTTACCAGGTGAAGG - Intergenic
934774948 2:96931429-96931451 GAGCAGGTGTTACTTGGAGGTGG + Intronic
939495706 2:142925627-142925649 GACCAGTACTGACCTGGAGCTGG + Intronic
943450946 2:188041129-188041151 AAACTGTTCTTACTTGGAGATGG + Intergenic
944305585 2:198174951-198174973 AATCAGTTGTTGCCTGGAGATGG - Intronic
948615237 2:239194167-239194189 GAGCAATTCTTACCTTCAGAGGG - Intronic
948938332 2:241182848-241182870 GGGCAGTTCTTCCGAGGAGAGGG - Exonic
1171196954 20:23207221-23207243 CAGAAGTTGTTGCCTGGAGAAGG + Intergenic
1171317927 20:24211708-24211730 GAGCAGTTCTTTCCTTCGGAAGG + Intergenic
1174938429 20:54897813-54897835 GGGCAGTTCTTCCCTGGCTAGGG - Intergenic
1175319618 20:58076128-58076150 CAGGAGCTCTTACCAGGAGAAGG - Intergenic
1175998770 20:62822686-62822708 GAGGGGTTCTGGCCTGGAGAGGG + Intronic
1179254640 21:39704702-39704724 CAGCAGTCCCTACCTGGGGAAGG + Intergenic
1179448756 21:41453131-41453153 GGGCACTTCTTACCTGGCGGCGG + Intronic
1180282179 22:10711485-10711507 TAGCACTTCATACCAGGAGATGG - Intergenic
1180707192 22:17817175-17817197 GAGCCGTGCTGACCTGGAGAAGG - Intronic
1180770495 22:18380762-18380784 GGGCAGTGCCTTCCTGGAGAGGG + Intergenic
1180808556 22:18739287-18739309 GGGCAGTGCCTTCCTGGAGAGGG - Intergenic
1180828437 22:18883720-18883742 GGGCAGTGCCTTCCTGGAGAGGG + Intergenic
1181071483 22:20344251-20344273 GGGCAGTGCCTTCCTGGAGAGGG - Intergenic
1181712263 22:24697898-24697920 GAACATTTCTTTCCTGGAGCTGG + Intergenic
1182896898 22:33866457-33866479 GAGCAGTTCCATCCTGCAGAAGG + Intronic
1185275848 22:49949963-49949985 GAGAAGTCCTTGGCTGGAGAGGG + Intergenic
1203232330 22_KI270731v1_random:121934-121956 GGGCAGTGCCTTCCTGGAGAGGG + Intergenic
1203278534 22_KI270734v1_random:109709-109731 GGGCAGTGCCTTCCTGGAGAGGG + Intergenic
951076592 3:18401024-18401046 GAGCAGCTGTTAGCTAGAGATGG - Intronic
951486496 3:23217875-23217897 GAAAAGTGCTTACCTGGAAATGG + Intronic
953306777 3:41838896-41838918 GAACAGTGCTTACCTGAAGCTGG + Intronic
955067323 3:55544459-55544481 GAGAACTTCTTAGGTGGAGAAGG - Intronic
955524713 3:59808378-59808400 GGGCTTTTCTGACCTGGAGATGG + Intronic
959932752 3:112000997-112001019 GAGCAGTTTTTACAAGGAGATGG - Intronic
961018417 3:123484563-123484585 GGGCAGGTATTTCCTGGAGAAGG + Intergenic
961175185 3:124829669-124829691 GAGCACTTCTTCCCTTGGGATGG - Intronic
961703821 3:128768096-128768118 GATCAGTGGTTACCTGGAGAGGG - Intronic
967117443 3:186354792-186354814 GAGGAGTTATGCCCTGGAGAAGG + Intronic
967562990 3:190939332-190939354 CTGCAGTTCTTGCCTGAAGAAGG + Intergenic
969213315 4:5704514-5704536 GAGAAGGTCTTGGCTGGAGATGG + Intronic
969540194 4:7784012-7784034 GAGCAGGTCCCACCTGAAGAAGG + Intronic
971471053 4:27027548-27027570 GAGCAGCTCTCACCAGCAGAAGG - Intergenic
972023464 4:34345129-34345151 GAGCAGTTCTCAACAGAAGAGGG - Intergenic
974080174 4:57203849-57203871 GATCGGTTCTTTCCTGGAGATGG + Intergenic
975039916 4:69734137-69734159 GAGAAATTCTTAACTGGAAAAGG - Exonic
975535797 4:75448546-75448568 GAGCTGCTATTACCTGAAGATGG - Intergenic
975892131 4:79042502-79042524 CAGTAGTTTTTATCTGGAGATGG + Intergenic
979133746 4:117082643-117082665 GGGCATTTCTTACCAGGAGTGGG + Intergenic
982126705 4:152189977-152189999 GATCTGTTCTCAACTGGAGAAGG - Intergenic
985521408 5:375577-375599 CACCAGTTCTGACCTTGAGATGG - Intronic
988790413 5:34602591-34602613 GAGCTGCTCTGTCCTGGAGATGG - Intergenic
992463254 5:76982749-76982771 GAACATTTCTTATTTGGAGAAGG - Intergenic
994751454 5:103742447-103742469 ATGCATTTCATACCTGGAGATGG + Intergenic
998345577 5:141459212-141459234 GACCAGTTGTTGCCTGGAGCTGG - Intronic
999476440 5:151903761-151903783 GAACAGTTCTTAACTGTGGATGG - Intronic
999528337 5:152433486-152433508 GATCAGTTGTTGCCTGGAGATGG + Intergenic
999743203 5:154572789-154572811 GAGATGTTCTGTCCTGGAGATGG - Intergenic
1000750949 5:165096674-165096696 GGGCACTTCTTACATGGCGATGG + Intergenic
1001022923 5:168198843-168198865 GATCAGGTCGAACCTGGAGAGGG - Exonic
1001026943 5:168232493-168232515 GAGCAGTGATTACATGGAGCTGG - Intronic
1002661669 5:180795153-180795175 GATCAGTTGTTGCCTGGGGATGG + Intronic
1003676184 6:8206582-8206604 GTCCAGTGCTGACCTGGAGAGGG + Intergenic
1004503299 6:16227544-16227566 AAGAGGTTCTTACCTGGGGAAGG + Intergenic
1005463652 6:26091507-26091529 GAACAGGGCCTACCTGGAGAGGG + Exonic
1006388184 6:33743747-33743769 GAGCATCTCTTCCCTGGAGAAGG + Intronic
1007980052 6:46144142-46144164 GAGCATTTCCTACCTCAAGAGGG - Exonic
1009502598 6:64434536-64434558 CAGCAGTTCTTTCCTGGTGGGGG + Intronic
1009572329 6:65402663-65402685 AATGGGTTCTTACCTGGAGAAGG + Intronic
1010017902 6:71125543-71125565 GAGCAGTTTTTACTTGCAAATGG - Intergenic
1010057110 6:71579321-71579343 GAGCAGTTCTTACCAGAAGCTGG - Intergenic
1010934811 6:81848586-81848608 GGGGAGTTCATACCTGGATAAGG - Intergenic
1014723943 6:124953063-124953085 GAGCAGATTTTACCTGTATATGG - Intergenic
1018543023 6:164903910-164903932 GAGAAGTTCATCCCTGCAGAAGG - Intergenic
1019015832 6:168878863-168878885 GGGCAGTTCTGACCTGGGGGGGG - Intergenic
1020345422 7:7157190-7157212 GAGAAGGTCTTACCTTGAGTGGG - Intronic
1021414117 7:20362175-20362197 AAGCAGTTCTGACCTGGAGGTGG - Intronic
1022794358 7:33720051-33720073 CAGAAGTTCTTACATGGACAAGG - Intergenic
1024220095 7:47280543-47280565 GAACAGTTGTTACCAGTAGACGG + Intronic
1025968768 7:66302115-66302137 GAGCAGTTCTTTCCTCCAGCAGG + Intronic
1028755783 7:94432952-94432974 GACCACTCCTTCCCTGGAGATGG - Intergenic
1030131622 7:106206581-106206603 GAGAAATTCTGACCTGCAGATGG + Intergenic
1030522651 7:110617611-110617633 GATCAGTAGTTACCTGGACATGG + Intergenic
1032277593 7:130473155-130473177 GATCAGTGATTACCTGGGGATGG + Intergenic
1034152247 7:148926137-148926159 GAGCACTGGTTACCTGGAGGTGG - Intergenic
1038084575 8:24180466-24180488 GAGCATAACTTACCTGGGGAAGG + Intergenic
1038770271 8:30472380-30472402 GAGCAGTGATTGCCTGGGGATGG + Intronic
1039498351 8:37998061-37998083 GAGCAGGTTTTACTGGGAGAAGG - Intergenic
1039604250 8:38867679-38867701 GAGCCATTGTTACCTGGAGGGGG + Intergenic
1041976852 8:63809275-63809297 GACCAGTGGTTACCTGAAGAGGG + Intergenic
1042665716 8:71203447-71203469 GCTCAGTTGTAACCTGGAGAGGG + Intronic
1042811502 8:72830483-72830505 AAGCAGTTCTTACATGAATAAGG - Intronic
1045434536 8:102148661-102148683 TATCAGTGCTTGCCTGGAGATGG + Intergenic
1045705435 8:104916893-104916915 GAGCAGTAGTTACCTGGGGCAGG - Intronic
1045776349 8:105807772-105807794 CAGCTGTCCTTACCTGGAGAAGG - Intergenic
1047778481 8:128092582-128092604 GAGGAGTTCCTAGCTGGAGTGGG - Intergenic
1048155348 8:131942942-131942964 GAGCAGTGGTTGCCTGAAGAGGG + Intronic
1051728288 9:20111337-20111359 GAACAGTTAACACCTGGAGAGGG - Intergenic
1051994541 9:23199567-23199589 GACCAGCTCTTACCTTGAGGTGG - Intergenic
1052363528 9:27586150-27586172 GAGAAGTTTTTATCTGGTGATGG - Intergenic
1052375911 9:27717337-27717359 GAGTACTTCTTGCCTGGAGCTGG + Intergenic
1053368052 9:37537723-37537745 GCCCAGTTCTTATCTGCAGATGG + Exonic
1055890160 9:81115665-81115687 AAGCAGGTCCTACCTGGTGATGG - Intergenic
1059203728 9:112443992-112444014 GAGCATTGCTTATGTGGAGATGG - Intronic
1061572339 9:131485523-131485545 GGCCAGGTCTTACCTGGAAAGGG + Intronic
1062506960 9:136882505-136882527 CAGCAGTTGGAACCTGGAGATGG - Intronic
1185795885 X:2964041-2964063 ATGCAGCTCTTTCCTGGAGAAGG - Intronic
1187604096 X:20864260-20864282 TTGCAGTTGTTGCCTGGAGAAGG - Intergenic
1190264164 X:48817587-48817609 GTGCAGTCCTTACCCAGAGAAGG + Intronic
1194864791 X:99052961-99052983 AAGCACTTCTTACATGGAGGTGG - Intergenic
1195293448 X:103451429-103451451 GAGCAGTGGTTGCCTGGAAATGG - Intergenic
1196007380 X:110850861-110850883 AATCACTTCTTACCTGGAGAAGG - Intergenic
1198691388 X:139288660-139288682 GAGCAGTGCTGACCAGGGGAAGG + Intergenic
1200035737 X:153328535-153328557 GGGCAGGTCATACCTGGAAAGGG + Intergenic
1200821627 Y:7590123-7590145 GAACAGCTCTTAACTGCAGAAGG + Intergenic
1201458693 Y:14199148-14199170 GAGCAGATCTTACAGGGAAATGG - Intergenic
1202238679 Y:22742631-22742653 GAACAGCTCTTAACTGCAGAAGG - Intergenic