ID: 914226551

View in Genome Browser
Species Human (GRCh38)
Location 1:145724029-145724051
Sequence ACATTGTTACGGAGCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914226551 Original CRISPR ACATTGTTACGGAGCTTTGG GGG (reversed) Intronic
907597347 1:55732176-55732198 AGACTGTTACTGAACTTTGGTGG + Intergenic
908670031 1:66535555-66535577 ACATTGTTAATGTGATTTGGGGG + Intronic
914226551 1:145724029-145724051 ACATTGTTACGGAGCTTTGGGGG - Intronic
918326105 1:183412132-183412154 ACAGAGATACGGAGCTCTGGAGG + Intronic
924516046 1:244767418-244767440 ACAGTGTTACTGGGCTTGGGGGG - Intergenic
1063920574 10:10928187-10928209 ACATTGTTCTGGAGCTAAGGGGG - Intergenic
1067342324 10:45416131-45416153 ACATTGTGTCGGTGTTTTGGGGG + Intronic
1080071002 11:28086659-28086681 ACATTGCTACTGAGAATTGGGGG - Intronic
1080795706 11:35561125-35561147 ACCTAGTTACGGAGTTTTTGAGG - Intergenic
1084975104 11:72792754-72792776 ACACTGTTTCTGAGCTTGGGAGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1113034090 13:106029500-106029522 ACATTGTTACCAAGCTCTTGGGG + Intergenic
1118943121 14:70356924-70356946 TGGTTGTTACGGAGCTTGGGTGG - Intronic
1119934332 14:78577053-78577075 AGAGTCTTAGGGAGCTTTGGGGG - Intronic
1121224881 14:92314270-92314292 ACATTTTTAGTTAGCTTTGGGGG - Intergenic
1124160748 15:27267061-27267083 ACATTGTTCCTGATCTTAGGGGG + Intronic
1128851354 15:70960205-70960227 CCAGTGTTACTGGGCTTTGGAGG + Intronic
1130406046 15:83602869-83602891 ACATTGTAAGTGGGCTTTGGAGG + Intronic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1155565121 18:27126175-27126197 TCATGGTTACGGAAGTTTGGAGG + Intronic
1162352700 19:10160374-10160396 AAATTCTTACGGTTCTTTGGGGG + Exonic
1166128976 19:40734217-40734239 ACAGTGTTACATAGCTGTGGGGG - Intronic
1168392998 19:56026075-56026097 AGATTGTTAAGAAGCTTTTGAGG + Intronic
926385767 2:12334329-12334351 ACATTGTTACTTAGGTTTGATGG + Intergenic
926825564 2:16902213-16902235 GGCTTGTTACTGAGCTTTGGTGG - Intergenic
926877660 2:17501034-17501056 TCATTATTATGGAGATTTGGGGG - Intergenic
939672846 2:145034848-145034870 CCATTGGTATGGAGTTTTGGTGG - Intergenic
1178766079 21:35452132-35452154 ACATTTTAACCGAGATTTGGAGG + Intronic
1179533485 21:42036046-42036068 ACATAGTCACGGGGCTGTGGAGG + Intergenic
950094771 3:10322392-10322414 AAACTGTCAAGGAGCTTTGGAGG + Intergenic
950572941 3:13813233-13813255 ACATAGGTAAGGAGCGTTGGGGG + Intergenic
953469467 3:43154761-43154783 ACATTGTGACAGAGTCTTGGAGG + Intergenic
957869863 3:86077528-86077550 AAATTGATCTGGAGCTTTGGAGG + Intergenic
965485589 3:169274210-169274232 TCATTTTTAGGAAGCTTTGGAGG - Intronic
973741098 4:53920201-53920223 ACATTGTTAAAGGGCTTTAGAGG + Intronic
977372903 4:96162736-96162758 AGATTGTGAGGGAGCTTTGTAGG + Intergenic
991996028 5:72387823-72387845 ACATAGTTACACAGCTTTGGGGG - Intergenic
995103924 5:108351965-108351987 ACATTGAAAAGTAGCTTTGGTGG + Intronic
1002403123 5:179004246-179004268 ACATTGTTACTGACCTTAGAGGG + Intergenic
1003392417 6:5725292-5725314 AAATTGGAAAGGAGCTTTGGAGG + Intronic
1005699220 6:28383373-28383395 CCTTTGTGACGGACCTTTGGAGG - Intronic
1010467875 6:76190377-76190399 ACATTGTTAGGAAGGTGTGGTGG + Intergenic
1010557387 6:77300494-77300516 ACATTGTCACTGATCTTTAGTGG + Intergenic
1013446366 6:110232530-110232552 ACATTGTTACTGGACTTAGGTGG + Intronic
1014302855 6:119705235-119705257 ACATTGTTATGAAGCTTTAGGGG + Intergenic
1017136784 6:151154128-151154150 ACATTGTCTCAGAGCTCTGGAGG - Intergenic
1025828221 7:65027931-65027953 ACATTGTTAGGTAGCTCTGCTGG + Intergenic
1031535029 7:122922834-122922856 ACATAGATTTGGAGCTTTGGGGG + Intergenic
1051656891 9:19391288-19391310 ACCTTGTTCCTGAGCTTAGGTGG - Intergenic
1056327130 9:85489338-85489360 ACACACTTATGGAGCTTTGGAGG + Intergenic
1056674625 9:88664737-88664759 ACATTGTCTCTGAGCTTTAGTGG - Intergenic
1058273776 9:103011388-103011410 ACATTGTCACATAGCTTTGATGG + Intronic
1058528077 9:105879811-105879833 ACCTTGTTAAGAAGCTGTGGGGG + Intergenic
1188703235 X:33292093-33292115 AGATTGTTACGGAAGTTTTGGGG - Intronic
1188758240 X:33991550-33991572 TAATTGCTACGGAGATTTGGTGG + Intergenic
1193262320 X:79423306-79423328 ACTTTGTTTCGGATATTTGGTGG + Intergenic