ID: 914227205

View in Genome Browser
Species Human (GRCh38)
Location 1:145730541-145730563
Sequence AAACTACTGCCCAAGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914227202_914227205 3 Left 914227202 1:145730515-145730537 CCTTAATTTTCATTTTCCAGATG No data
Right 914227205 1:145730541-145730563 AAACTACTGCCCAAGGAGTTAGG 0: 1
1: 0
2: 2
3: 18
4: 196
914227201_914227205 4 Left 914227201 1:145730514-145730536 CCCTTAATTTTCATTTTCCAGAT No data
Right 914227205 1:145730541-145730563 AAACTACTGCCCAAGGAGTTAGG 0: 1
1: 0
2: 2
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914227205 Original CRISPR AAACTACTGCCCAAGGAGTT AGG Intronic
900381607 1:2386963-2386985 AGACTACTGGGCAAGGAGCTGGG + Intronic
901309673 1:8259347-8259369 AAACAATTGCCCAAGGTCTTGGG - Intergenic
903306983 1:22419855-22419877 AAACTGAGGCCCAGGGAGTTTGG + Intergenic
904855724 1:33496967-33496989 AAACTGTTGACCAAGGACTTCGG + Intergenic
906014419 1:42561923-42561945 AAACCACTGCTCAAGGAAATAGG + Intronic
907882324 1:58562568-58562590 AAACCACTGCTCAAGGAAATAGG + Intergenic
909033847 1:70574285-70574307 AAAATTCAGCCCAAGGAGTCAGG - Intergenic
909034943 1:70586303-70586325 AACCATCTCCCCAAGGAGTTTGG - Intergenic
909755220 1:79217516-79217538 AAACAGCTCCTCAAGGAGTTTGG - Intergenic
910751545 1:90636524-90636546 AAACCACTGCTCAAGGAAATAGG + Intergenic
911660827 1:100499496-100499518 AAACTACTTAAAAAGGAGTTGGG - Intronic
912166760 1:107050725-107050747 AAACCACTGCCCAAGGAAATAGG - Intergenic
912799326 1:112711305-112711327 AGAGTTCTGCCCAAGGAGCTGGG - Exonic
914227205 1:145730541-145730563 AAACTACTGCCCAAGGAGTTAGG + Intronic
915666433 1:157449285-157449307 AAAACAATGCCCAAGGTGTTTGG + Intergenic
917915657 1:179698776-179698798 AAACCACTGCTCAAGGAAATAGG + Intergenic
919047367 1:192470286-192470308 AAACTCCTGCCCCAGGAGTAGGG - Intergenic
920073326 1:203319200-203319222 GGGCTACTGCACAAGGAGTTTGG - Intergenic
920957047 1:210629230-210629252 AAACTAATGCCCAAGGCCTCTGG - Intronic
923637138 1:235710184-235710206 AAAATACTTCCCAAGTATTTTGG - Intronic
1067494958 10:46753555-46753577 AAAACACTGCCCTAGGAGATGGG + Intergenic
1067599698 10:47586841-47586863 AAAACACTGCCCTAGGAGATGGG - Intergenic
1068567996 10:58596878-58596900 AAACCACTGCTCAAGGAAATAGG + Intronic
1068968376 10:62936639-62936661 AAAGTAGTGCCCAAGCAGTCAGG + Intergenic
1070016285 10:72535385-72535407 AAACTACTGCCAAAGGACAGCGG + Intronic
1071395687 10:85221547-85221569 TGACTACTGCGCAAGGAGTGTGG + Intergenic
1071651229 10:87394727-87394749 AAACCACTGCCCTAGGAGATGGG - Intergenic
1073636527 10:105204401-105204423 AAACTCATCCCCAAGGACTTGGG + Intronic
1073749442 10:106507354-106507376 AAATTACAGCGAAAGGAGTTTGG - Intergenic
1073785759 10:106888008-106888030 AGACTAAGGCCCAAGGAGTTGGG - Intronic
1074925916 10:118070523-118070545 AAACGCCTTGCCAAGGAGTTGGG + Intergenic
1075466377 10:122654364-122654386 AACCACCTGTCCAAGGAGTTTGG + Intergenic
1077942988 11:6863508-6863530 AAACTGATGCCCAAGGAGAGAGG - Intergenic
1078291145 11:10010904-10010926 AAACCACTGCTCAAGGACATAGG - Intronic
1081211435 11:40339534-40339556 AAAGTACTGCTCAAGGCATTGGG - Intronic
1081752499 11:45521905-45521927 AAACTCTTGTCCATGGAGTTTGG - Intergenic
1081828931 11:46089543-46089565 ATACTACTGCACAAAGAGCTTGG + Intronic
1084917227 11:72437931-72437953 AAACTCCTGCCCCAAGTGTTGGG - Intergenic
1085702379 11:78756609-78756631 AAACTACTCTCCAAGGAGTTTGG - Intronic
1087706733 11:101501769-101501791 AAATTACTGCACAAGGAGAAAGG - Intronic
1092603389 12:10091952-10091974 CAACTACTGCCCTAGGAATTGGG - Intronic
1093004846 12:14040250-14040272 AAACCACTGCTCAAGGAAATAGG + Intergenic
1094645813 12:32323139-32323161 AAACTATTGCCCAAATAGTCTGG + Intronic
1097521927 12:60680649-60680671 ACACAGCTGCCCAAGGACTTGGG - Intergenic
1099881853 12:88476702-88476724 AAACCACTGCTCAAGGAAATAGG + Intergenic
1102015531 12:109645570-109645592 AATCTACTGCCCTATGAGGTTGG - Intergenic
1103047145 12:117745906-117745928 AAACCACTGCTCAAGGAAATAGG + Intronic
1108481669 13:50878555-50878577 AAACTCCTTCACATGGAGTTTGG - Intergenic
1108780621 13:53826745-53826767 AAAATACTGCCCAGGGAGTTTGG + Intergenic
1108941872 13:55964855-55964877 AAACTTCTGACTCAGGAGTTTGG - Intergenic
1109597443 13:64574796-64574818 AAACTACTGCCCCCGTAATTTGG - Intergenic
1113713281 13:112485115-112485137 ATACTACTGACCAAGATGTTGGG - Exonic
1114262791 14:21050598-21050620 AAAGTAGTGCCCAATGAGCTTGG + Intronic
1120797689 14:88652965-88652987 AAACCACTGCTCAAGGAAATAGG - Intronic
1120817984 14:88883296-88883318 AAGCTGCTGCCCAAGGCCTTGGG - Intergenic
1121532945 14:94671268-94671290 AATCTGATGCCCAAGGAATTTGG + Intergenic
1130122611 15:81064376-81064398 ATACTATTGCCAAAGGAATTTGG + Intronic
1137474228 16:48792882-48792904 AAACTTGTGCCTAATGAGTTAGG - Intergenic
1138184585 16:54966639-54966661 AAACTGGTGCTCAAGGAGGTAGG - Intergenic
1139511817 16:67432080-67432102 AAACTACTGCCTCAGCAGTTTGG - Intronic
1139617628 16:68108741-68108763 AAACCACTGCTCAAGGAAATCGG - Intronic
1140713183 16:77697037-77697059 AAACAAATGGCCAAGTAGTTTGG - Intergenic
1143625344 17:8107133-8107155 AAACAACTGCCCAAGGAGGGAGG + Intronic
1144771328 17:17761265-17761287 TAACTAGTGCCCAAGGAAGTGGG + Intronic
1150463350 17:65371292-65371314 AGACCACAGCCCTAGGAGTTAGG + Intergenic
1151060950 17:71093872-71093894 AAACCACTGCTCAAGGAAATAGG + Intergenic
1156128601 18:33939440-33939462 AAACCACTGCTCAAGGAAATAGG - Intronic
1159592459 18:70350002-70350024 AAACTACTTCCTTAGGAGTAAGG + Intronic
1160027078 18:75227199-75227221 AAACTTCTGCCGCAGGAGTGGGG - Intronic
1160168647 18:76534615-76534637 CAACTACTCACCAAGGACTTAGG + Intergenic
1161769695 19:6224410-6224432 AAGCTACTACCCAAGGAGGGAGG + Intronic
1163264454 19:16210481-16210503 AAACTACTGACAAAGGATGTGGG - Intronic
1166328796 19:42067043-42067065 CAACCACTGGGCAAGGAGTTTGG + Intronic
929803569 2:45125032-45125054 TAAGTACTGAACAAGGAGTTAGG - Intergenic
932269646 2:70398417-70398439 AAACTACTGCCATGGGAGTGGGG - Intergenic
934660554 2:96141279-96141301 TAACTACGGCCCTAGGAGTGAGG - Intergenic
935915279 2:107942949-107942971 GAGCTACTGCTCACGGAGTTGGG + Intergenic
939192631 2:138933791-138933813 AAACCACTGCTCAAGGAAATAGG + Intergenic
940403336 2:153271591-153271613 AAACCACTGCTCAAGGAAATAGG + Intergenic
940712189 2:157176063-157176085 AAACTAATGACCAAGATGTTTGG - Intergenic
941583703 2:167331386-167331408 TGACCACTGCCCAAGGACTTGGG - Intergenic
942488913 2:176469968-176469990 AAACTAGTGCCTTTGGAGTTGGG + Intergenic
942579053 2:177396782-177396804 AAATTAATGCCACAGGAGTTTGG + Intronic
943175919 2:184474170-184474192 ATACTTCTGCCCAAGGCTTTTGG - Intergenic
943237858 2:185346299-185346321 ATTCTACTGGCTAAGGAGTTGGG - Intergenic
943243105 2:185412732-185412754 AAACCACTGCTCAAGGAAATAGG - Intergenic
943397304 2:187355975-187355997 AAACCACTGCTCAAGGAAATAGG + Intronic
945409588 2:209492763-209492785 AAACCACTGCTCAAGGAAATAGG + Intronic
946112753 2:217434569-217434591 AAACAACTGGCCAGGGAGTCAGG + Intronic
947562670 2:231171201-231171223 AAAATACTGTCGAAGGAGATGGG - Intronic
947832806 2:233153721-233153743 AATCTTCTGCCAAAGGAGTGAGG - Intronic
1171085744 20:22236628-22236650 AGGCTACTGCCCAAGGAGGATGG - Intergenic
1174022660 20:47543396-47543418 AGACTACTTCCCAGGGAGTGTGG + Intronic
1175464592 20:59181932-59181954 AAACCACTGCTCAAGGAAATAGG - Intergenic
1176520835 21:7822890-7822912 AAATTGCTGCCCAAGGATTTGGG + Intronic
1178654857 21:34452902-34452924 AAATTGCTGCCCAAGGATTTGGG + Intergenic
1183847792 22:40556937-40556959 AAACTTCAGCCCTAGGACTTAGG + Intronic
951714481 3:25625093-25625115 AAACTACTGTTAAAGGAGTTTGG - Intronic
951777471 3:26325527-26325549 AAACTACTGCCTATGGAATTTGG - Intergenic
951982461 3:28580743-28580765 AAACAATCGCCCAAGGGGTTAGG - Intergenic
953647176 3:44766381-44766403 GAACCACTGCCTAATGAGTTGGG + Intronic
955882856 3:63566183-63566205 AAACTAGTGCCCAAGTTGCTAGG - Intronic
956409307 3:68962565-68962587 AAACTATGGCCCAGGGAGTGGGG + Intergenic
956592609 3:70930908-70930930 AAACTACTGCTTAGGGAGTATGG - Intergenic
957926348 3:86818024-86818046 ATACTACTGCCCTACGTGTTAGG + Intergenic
958179231 3:90036221-90036243 AAAATACAGTCCAAGGATTTTGG + Intergenic
958573769 3:95921033-95921055 AAACAAGTGCCCAAGGTGGTTGG + Intergenic
958996258 3:100908732-100908754 AAACCACTGCTCAAGGAAATAGG + Intronic
959829561 3:110844168-110844190 AAATCACTGCTCAAGGAATTAGG + Intergenic
960383197 3:116989515-116989537 AAACTGCTGCTCAAGGACATTGG + Intronic
960491670 3:118322880-118322902 AAACCACTGCTCAAGGAAATAGG + Intergenic
960515543 3:118598505-118598527 AAATTACTCCCCAAAGGGTTAGG - Intergenic
960769059 3:121171674-121171696 AAACCACTGCTCAAGGAAATAGG + Intronic
963017483 3:140839756-140839778 CAACTGCTGGCCAAGGGGTTAGG - Intergenic
963400055 3:144786938-144786960 AAACCACTGCTCAAGGAAATAGG - Intergenic
964294760 3:155221283-155221305 AAACCACTGCTCAAGGAAATAGG - Intergenic
964807742 3:160630214-160630236 AAACCACTGCTCAAGGAAATTGG + Intergenic
965114117 3:164465816-164465838 AGACAACTGCCCAAGGTGGTAGG - Intergenic
967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG + Intronic
970261423 4:14228820-14228842 AAACTACTGCTCAAGGTTCTTGG + Intergenic
970954325 4:21792996-21793018 AAGCTACTGCCTTAGGTGTTTGG + Intronic
972691650 4:41404451-41404473 AAAATACTCCCCAAGGAGCAAGG - Intronic
973728218 4:53797230-53797252 AAACACCTTCACAAGGAGTTTGG + Intronic
974010659 4:56604245-56604267 AAACTGCAGCACAGGGAGTTAGG - Intergenic
974215849 4:58846611-58846633 AAACCAATGCCCAAGGATGTAGG + Intergenic
975693907 4:76992983-76993005 AAATGACAGGCCAAGGAGTTTGG + Intronic
978900029 4:113937864-113937886 AAACCACTGCTCAAGGAAATTGG + Intronic
979721619 4:123906423-123906445 AAACTACTTCCCAAGCAAATGGG - Intergenic
980336274 4:131477622-131477644 GAACTACTGCTCAAGGAAATAGG + Intergenic
981569450 4:146135891-146135913 CAACTACAGCCAAAGGAATTTGG + Intergenic
984744213 4:183198051-183198073 AAACTGCCTCCCAAGTAGTTGGG - Intronic
984903532 4:184606284-184606306 AAACCACTGCTCAAGGAAATGGG + Intergenic
985710080 5:1423044-1423066 ACAGTACTGCCCAAGGTGCTGGG + Intronic
987373140 5:17211385-17211407 AAACTACTGACACAGTAGTTGGG + Intronic
987598882 5:20039169-20039191 AAACCACTGCTCAAGGAAATAGG + Intronic
990136960 5:52657326-52657348 AAAATGCTGCGGAAGGAGTTGGG - Intergenic
990827569 5:59919172-59919194 AAAATACTCCCCAAGCAGGTTGG + Intronic
990954216 5:61327993-61328015 AAACCACTGCTCCAGGAATTTGG + Intergenic
992512000 5:77446250-77446272 AAACCACTGCTCAAGGAAATGGG + Intronic
993728817 5:91398553-91398575 AATCTCCTGCCCAAGGGGGTGGG - Intergenic
993821202 5:92619132-92619154 AAACCACTGCTCAAGGAAATAGG - Intergenic
993911956 5:93694513-93694535 AAACCACTGCTCAAGGAAATAGG + Intronic
995798938 5:115970936-115970958 AAACTGTTTTCCAAGGAGTTTGG + Intronic
995923954 5:117346463-117346485 AAATTAATACCCAAGGTGTTGGG + Intergenic
996128531 5:119753362-119753384 CAACTCCTGCCCAAGGGGTGGGG - Intergenic
998118021 5:139553342-139553364 AGAGTACAGCCCAAGCAGTTTGG - Intronic
1001548870 5:172587595-172587617 GAACAACTGGCCCAGGAGTTTGG - Intergenic
1002518752 5:179778464-179778486 AAACTGCTGCCCTAGGGGATTGG + Intronic
1003710662 6:8585943-8585965 AAACCACTGCTCAAGGAAATAGG - Intergenic
1005791829 6:29310775-29310797 AAACCACTGCTCAAGGAGAGAGG - Intergenic
1005795034 6:29350880-29350902 AAACCACTTCTCAAGGAATTAGG - Intergenic
1007672450 6:43567014-43567036 AAACTCCTGTCCAAGGGGGTTGG + Intronic
1013390712 6:109683724-109683746 AAACCACTGCTCAAGGAAATAGG + Intronic
1013715008 6:112949569-112949591 AAAGTACTGCTCTAGTAGTTGGG + Intergenic
1017346553 6:153390178-153390200 AAATTACTGTCCAAGGACTGTGG + Intergenic
1017408370 6:154143544-154143566 AAACTACTGGGAAAGGAGTTTGG + Intronic
1017836844 6:158186648-158186670 CAACTTGTGCCCAAGGTGTTCGG + Intronic
1020005570 7:4782297-4782319 AAACTCCTGGCCAAGGAGGGTGG - Intronic
1020390995 7:7657978-7658000 AAACCACTGCTCAAGGAAATAGG - Intronic
1021214887 7:17903455-17903477 AAACTACAGACTTAGGAGTTAGG + Intronic
1023085045 7:36561963-36561985 AAACAGCTACCCAAGGAGTGAGG + Intronic
1025985583 7:66448250-66448272 AAAATATTGACCCAGGAGTTAGG + Intergenic
1026002417 7:66571390-66571412 AAAATATTGACCCAGGAGTTAGG + Intergenic
1027208803 7:76126782-76126804 AAAATATTGACCCAGGAGTTAGG + Intergenic
1027717581 7:81692382-81692404 ACACTACTGCCAAAGGAATTTGG + Intergenic
1027995169 7:85416735-85416757 AAACTAGGGTCCAAGGGGTTGGG - Intergenic
1028233802 7:88336472-88336494 ATACTATTTTCCAAGGAGTTTGG - Intergenic
1030641680 7:112013404-112013426 AAACTATTTCTCAAGGAGATAGG + Intronic
1031081151 7:117258099-117258121 GAACATGTGCCCAAGGAGTTTGG + Intergenic
1037822685 8:22142500-22142522 AAACTTCTGCTGAAGGAGTGTGG - Intergenic
1039994119 8:42516697-42516719 GAACTGCTGCTAAAGGAGTTTGG - Intronic
1040536382 8:48314706-48314728 AAACCACAGCCCAAGGAGAAAGG - Intergenic
1040911578 8:52524496-52524518 AAACTTGTGTCCCAGGAGTTTGG + Intergenic
1040946874 8:52893642-52893664 AAACTACGGCACCAGGAGGTGGG - Intergenic
1041322790 8:56632057-56632079 AAACCACTGCTCAAGGAAATAGG - Intergenic
1041999148 8:64101781-64101803 AAACTACTGCCAAAGAAATTAGG - Intergenic
1042018881 8:64348116-64348138 AAACCACTGCTCAAGGAAATAGG - Intergenic
1042026020 8:64424549-64424571 AAACTACTTTACAATGAGTTTGG - Intergenic
1042760033 8:72261319-72261341 AAACCACTGCTCAAGGAAATAGG + Intergenic
1042954624 8:74236574-74236596 AAACGACTGCCCGAGGAATGCGG - Exonic
1043204998 8:77426660-77426682 AAAGAACTGCCCAAGGCCTTGGG + Intergenic
1045970945 8:108079630-108079652 AACATAATGCCAAAGGAGTTCGG + Intronic
1047557976 8:125953891-125953913 AAACCACTGCTCAAGGAAATAGG + Intergenic
1047999473 8:130366022-130366044 AAACTGATTCCCAAGCAGTTAGG + Intronic
1049523822 8:143110322-143110344 GAACAAGTGCCCAAGGTGTTTGG - Intergenic
1050811566 9:9754370-9754392 AAACTACTGTTCAAGGAGCAAGG + Intronic
1051830562 9:21271298-21271320 AAACCACTGCTCAAGGAAATAGG - Intergenic
1055485132 9:76749091-76749113 AAACAACAGCCAAAGAAGTTAGG + Intronic
1055637084 9:78289577-78289599 AGATGACTGCCCAAGGATTTGGG - Intergenic
1056600914 9:88046216-88046238 GAACTGGTGCCCAAGGTGTTTGG - Intergenic
1057705727 9:97393621-97393643 ACACAAGTCCCCAAGGAGTTGGG - Intergenic
1057834241 9:98431405-98431427 CAAGTACTGCCCTAGGAGCTAGG - Intronic
1058374774 9:104309732-104309754 AAACCACTGCTCAAGGAAATAGG + Intergenic
1058544092 9:106042144-106042166 AAACTAGTGACAAAGAAGTTTGG - Intergenic
1058566944 9:106296217-106296239 AAATTACTTCCCAAGTATTTGGG - Intergenic
1059298548 9:113294607-113294629 AAACTCCTGACCAAAGTGTTGGG - Intergenic
1059374806 9:113873844-113873866 AAACTCCTGCCCTGGGAGTCGGG - Intergenic
1185914429 X:4019556-4019578 AAACACCTGCCCAAGGTGTTTGG - Intergenic
1186270833 X:7886523-7886545 AAAAGAGTGCCCAAGGACTTAGG + Intergenic
1188025873 X:25208904-25208926 ATACTAATGGCCTAGGAGTTGGG + Intergenic
1192141349 X:68649390-68649412 AGACTACTTCCCAAAGGGTTTGG + Intronic
1193068972 X:77287304-77287326 AAACTACTGCTCAAGGAAATAGG + Intergenic
1193162879 X:78247479-78247501 AAACTACTGACTCAGGGGTTTGG - Intergenic
1193240996 X:79169208-79169230 AAAAATCTGCCCAAGGAGCTTGG + Intergenic
1193249902 X:79278682-79278704 AAACCACTGCTCAAGGAAATAGG + Intergenic
1193358924 X:80556972-80556994 AAACTTCTCCCCAAGGAGGGAGG + Intergenic
1193985501 X:88236651-88236673 AAACTACTGCTCAAAGAAATAGG - Intergenic
1194199821 X:90941001-90941023 AAACCACTGCTCAAGGAATTCGG + Intergenic
1194905281 X:99568194-99568216 AAACCACTGCTCAAGGAAATAGG - Intergenic
1194977691 X:100410266-100410288 AAACTACTGGCCGCGGAGTCTGG + Exonic
1195579432 X:106484590-106484612 AAACTTCTGTCCAAAGAGTGGGG - Intergenic
1196569080 X:117244639-117244661 AAACTGCAGCATAAGGAGTTAGG + Intergenic
1197368216 X:125593643-125593665 AAACCACTGAATAAGGAGTTGGG - Intergenic
1198103696 X:133442942-133442964 AAAGTACTGCCCAAAGAGCTTGG - Intergenic
1198733240 X:139756906-139756928 AAACTCATGCCACAGGAGTTTGG - Intronic
1199966956 X:152828565-152828587 AAACGCGTGGCCAAGGAGTTGGG - Exonic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic