ID: 914227535

View in Genome Browser
Species Human (GRCh38)
Location 1:145733541-145733563
Sequence TTGAATTAACTAGGAACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914227535_914227537 23 Left 914227535 1:145733541-145733563 CCTATGGTTCCTAGTTAATTCAA No data
Right 914227537 1:145733587-145733609 TGACTTTGTTCCTTGCTTCCTGG 0: 1
1: 0
2: 3
3: 15
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914227535 Original CRISPR TTGAATTAACTAGGAACCAT AGG (reversed) Intronic
No off target data available for this crispr