ID: 914227537

View in Genome Browser
Species Human (GRCh38)
Location 1:145733587-145733609
Sequence TGACTTTGTTCCTTGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 342}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914227536_914227537 14 Left 914227536 1:145733550-145733572 CCTAGTTAATTCAAATTTTCAAC No data
Right 914227537 1:145733587-145733609 TGACTTTGTTCCTTGCTTCCTGG 0: 1
1: 0
2: 3
3: 15
4: 342
914227535_914227537 23 Left 914227535 1:145733541-145733563 CCTATGGTTCCTAGTTAATTCAA No data
Right 914227537 1:145733587-145733609 TGACTTTGTTCCTTGCTTCCTGG 0: 1
1: 0
2: 3
3: 15
4: 342
914227534_914227537 26 Left 914227534 1:145733538-145733560 CCTCCTATGGTTCCTAGTTAATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 914227537 1:145733587-145733609 TGACTTTGTTCCTTGCTTCCTGG 0: 1
1: 0
2: 3
3: 15
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914227537 Original CRISPR TGACTTTGTTCCTTGCTTCC TGG Intronic
900466939 1:2830287-2830309 TGACTCTGCCCCTGGCTTCCTGG - Intergenic
901860517 1:12071537-12071559 TGCCTGTGTTCCTTGGTCCCTGG + Intronic
904767218 1:32859488-32859510 TCCCTTTTTTCCTTGCTTCTGGG - Intergenic
905292568 1:36932462-36932484 TTTCTTTGTTCATTGCTACCAGG + Intronic
905424695 1:37873966-37873988 GGCCTCTGTTCCTAGCTTCCTGG - Intronic
905496194 1:38389897-38389919 TGACTTTATTTCCTGCATCCAGG + Intergenic
905649831 1:39648761-39648783 TGAACTTGTTACTTGCTTGCTGG - Intergenic
906096643 1:43228610-43228632 TGACTTTTTCCCTGGCTTCTGGG + Intronic
906555280 1:46706334-46706356 TTACTTTGTGTCTAGCTTCCTGG + Intronic
906858980 1:49338674-49338696 TTACTTAGTTCCTTGCTTCCTGG - Intronic
907041913 1:51268838-51268860 TGGCTTTGGTCCTGGCTTTCTGG - Intronic
907524103 1:55043983-55044005 TGGCCTTCTTCCTGGCTTCCTGG + Exonic
908150784 1:61299772-61299794 TGTCTTAGTTCTGTGCTTCCTGG + Intronic
909549677 1:76883822-76883844 ATTCATTGTTCCTTGCTTCCTGG - Intronic
910150291 1:84134304-84134326 TCACTTTGGGCCGTGCTTCCAGG + Intronic
910334588 1:86112620-86112642 TGACTTTTTTCGTTACTTGCAGG - Exonic
910369968 1:86504866-86504888 TGAAATTGTTCCTTGCTTAAAGG - Intergenic
910486082 1:87715827-87715849 TAAGTGTGTTCCTTGCTTTCTGG - Intergenic
911083282 1:93954807-93954829 TCACTTTGTTCATTGTTTTCTGG + Intergenic
911140320 1:94494299-94494321 TAACCATGTTCCTTACTTCCTGG + Intronic
912068727 1:105780020-105780042 TGACTCAGTTCCTTACATCCAGG - Intergenic
913663146 1:121022110-121022132 AGACTTTGTCCTTTGGTTCCTGG - Intergenic
914014531 1:143805375-143805397 AGACTTTGTCCTTTGGTTCCTGG - Intergenic
914163289 1:145155826-145155848 AGACTTTGTCCTTTGGTTCCTGG + Intergenic
914227537 1:145733587-145733609 TGACTTTGTTCCTTGCTTCCTGG + Intronic
914653155 1:149713932-149713954 AGACTTTGTCCTTTGGTTCCTGG - Intergenic
914954820 1:152152121-152152143 TGACTTTGTGCCTTGCATAATGG + Intergenic
915071163 1:153268888-153268910 GGAATTTGTTCATTTCTTCCAGG + Intergenic
916264421 1:162876412-162876434 TGACCTTCTTTCTTGCTTCAAGG + Intergenic
918806315 1:189050582-189050604 TGACTTTTTCACTTTCTTCCTGG + Intergenic
919336007 1:196234779-196234801 TGACTTTGTCACTTGCTTTCTGG + Intronic
919355108 1:196512197-196512219 TGATTTTCTTCCTACCTTCCAGG + Intronic
920265284 1:204716922-204716944 GAACTTTGTTCCCTGTTTCCAGG - Intergenic
920278476 1:204826070-204826092 TGACTTTTGTCCTTGGCTCCTGG - Intergenic
921407708 1:214799288-214799310 AGACTTTGTCCTTTGTTTCCTGG + Intergenic
921956501 1:220990262-220990284 TGATTTTGTTAATTGCTTTCTGG + Intergenic
922779359 1:228239752-228239774 GGACTTTGGTCCTTAATTCCTGG + Intronic
923595431 1:235357698-235357720 TGTCTTTCTTCCTGGCTTCGAGG - Intergenic
1063071927 10:2675432-2675454 GGACTTGGTTCCTTTCCTCCTGG - Intergenic
1063116680 10:3076620-3076642 TCACTGTGTTTCTTGCTTTCGGG + Intronic
1063329931 10:5147642-5147664 TGACTTTGTGTCCTGCATCCTGG + Intergenic
1063741552 10:8827581-8827603 TGATTGTGTTCCTCTCTTCCAGG + Intergenic
1068443457 10:57089928-57089950 TGACTTCGTCCCTGGCTCCCTGG + Intergenic
1072792305 10:98327139-98327161 GGCCTCTCTTCCTTGCTTCCAGG + Intergenic
1073025953 10:100487496-100487518 CGACTCTTTTCCTTGCTGCCAGG - Exonic
1074222321 10:111450228-111450250 TGTCTTTGGTCCTTGTTTACAGG - Intergenic
1075636495 10:124034488-124034510 TGAGTATGTTTCTTTCTTCCTGG - Intronic
1075681763 10:124338469-124338491 TGACCTTCTTCCTGGCTTGCAGG + Intergenic
1077729911 11:4719307-4719329 AGGCTTTCTTCCTTTCTTCCGGG - Intronic
1077768617 11:5190303-5190325 GGACACTGTTCCTTGCATCCTGG + Intergenic
1078461962 11:11521010-11521032 TGCCCTTGTTCCTGGCTACCTGG + Intronic
1079353300 11:19711660-19711682 TGTCTTTCTTCTTTGTTTCCAGG - Intronic
1079722914 11:23842017-23842039 AGACTTTGTTCATTTCTTCTAGG + Intergenic
1079765311 11:24385029-24385051 TGACTTTATTCCATGCTGGCAGG + Intergenic
1080101224 11:28462039-28462061 TCACATTGTTCAATGCTTCCAGG - Intergenic
1080825757 11:35847600-35847622 TGGCCATGTGCCTTGCTTCCTGG + Intergenic
1080872148 11:36245817-36245839 TGCCTTTGGTCTTTTCTTCCTGG - Intergenic
1082559222 11:54599281-54599303 TGCCTCTGTGCCTTGCCTCCAGG + Intergenic
1083430169 11:62610202-62610224 GGACTTTCTTGCTTGCCTCCCGG - Intronic
1083511124 11:63210272-63210294 TTTCTTTCTTCCTTTCTTCCCGG - Intronic
1084809207 11:71602567-71602589 TGACATTGTTCCTTCTATCCTGG + Intronic
1085272107 11:75276495-75276517 ATACTTTGTTCTTGGCTTCCTGG - Intronic
1086025792 11:82289899-82289921 TGACCTTGTTCCTTTCACCCAGG + Intergenic
1086189294 11:84059484-84059506 TGACTCTTTTCCTTCCTTGCAGG - Exonic
1086485869 11:87301035-87301057 TGAATTTGTTTCTTACTTACGGG - Intronic
1087118923 11:94552712-94552734 TGACATTGGTCCTTGCCTCCTGG + Intronic
1088022702 11:105138956-105138978 TCACTTTGTTCATGTCTTCCTGG + Exonic
1088250343 11:107856851-107856873 TGCCTTCCTTCCTTCCTTCCTGG - Intronic
1089294951 11:117461819-117461841 AGACTTGGTTCCTTGCTCTCTGG + Intronic
1089809732 11:121121765-121121787 AGACTTTGTCCCTTGCTAGCAGG + Intronic
1090972163 11:131653328-131653350 TCACAGTCTTCCTTGCTTCCAGG + Intronic
1091217013 11:133908275-133908297 AGCCTTTGTTTCTTGGTTCCTGG - Intergenic
1091745109 12:2986974-2986996 TGACTGCGTTCCTAGCTTTCTGG + Intronic
1092510695 12:9153045-9153067 AAACTCTGTTCCTTCCTTCCTGG - Intronic
1094253249 12:28391282-28391304 TGACTTTTTTGCTTGTTTTCAGG + Exonic
1095448755 12:42307619-42307641 TGACTCTCTTCCTTATTTCCAGG + Intronic
1095588540 12:43876146-43876168 TGACTTTGTCCTTTCCTTTCCGG + Intronic
1095870576 12:47023335-47023357 TTACTTTGTTTCTAGATTCCTGG + Intergenic
1095984724 12:47991692-47991714 TGTCCTTGTTCCCTCCTTCCTGG - Intronic
1096209337 12:49751288-49751310 TGATTTTGATCATTGCTTTCAGG + Intronic
1096334168 12:50740426-50740448 TGACTGTGTTTCTTGCCTCATGG + Intronic
1096459036 12:51811852-51811874 TGACTTTGTGACTTGAGTCCTGG + Exonic
1096461958 12:51826669-51826691 TGACCTGGTGCCCTGCTTCCTGG - Intergenic
1096769264 12:53923727-53923749 TGGCTTTGTCTCTTGTTTCCTGG + Intergenic
1097718003 12:62987593-62987615 TGAATTTGCTACTTGCATCCAGG + Intergenic
1098433565 12:70446419-70446441 TGAAATTGTTCCTTGCTTAAAGG + Intergenic
1098490096 12:71065373-71065395 TATCTTTGTTTCATGCTTCCTGG - Intronic
1098695580 12:73550099-73550121 AGACTTTGCGCCTTGCTTCTAGG + Intergenic
1098987465 12:77028154-77028176 TAACTTACTTTCTTGCTTCCTGG - Intronic
1099368437 12:81798862-81798884 ATACTATGTTCCTTGCTTACAGG - Intergenic
1100036740 12:90260706-90260728 TGACTTTGTTTCTGGCATCATGG - Intergenic
1102213336 12:111143143-111143165 TGAATTTGCTCCTGGCTTCGGGG + Intronic
1102532554 12:113557504-113557526 AGACATTGTTCCTTGCCTCAGGG + Intergenic
1104553131 12:129775714-129775736 TGACTTTATTCCTGCCTCCCAGG + Intronic
1105284546 13:18993624-18993646 TCACTTCCTTCCTTCCTTCCTGG - Intergenic
1105588723 13:21770761-21770783 TTACTTTGGTCTTTGCTTTCAGG + Intergenic
1106260862 13:28065514-28065536 TGCCTGTGGTCCTTGCTACCCGG + Intronic
1106555533 13:30805285-30805307 AGACCTTGTACCTTGCTTCCTGG - Intergenic
1106670865 13:31903581-31903603 TGACATTTTTCCTGTCTTCCTGG + Intergenic
1106739921 13:32629666-32629688 TGGTTTTGTACCTTGCTTACAGG + Intronic
1108024582 13:46164085-46164107 TGACATTGTTCCATGCTTTCAGG - Intronic
1108896386 13:55334291-55334313 GGACACTGTTCCTTGCCTCCTGG + Intergenic
1112901778 13:104365623-104365645 TGACTCAGCTCCTTGCTACCTGG + Intergenic
1113357026 13:109590580-109590602 TGGCTTTGTCCTTTACTTCCTGG + Intergenic
1114170853 14:20271272-20271294 TGACAGTGCTCCCTGCTTCCTGG - Intronic
1114717803 14:24845888-24845910 TGATTATGTTCCTTGGTTCATGG - Intronic
1115439502 14:33416024-33416046 TGTCTTTGTTCCCTGCTACATGG + Intronic
1116366011 14:44064552-44064574 GGAATTTGTTCCTTTCTTCTAGG - Intergenic
1116971634 14:51072028-51072050 TTCCTTTCTTCCTTCCTTCCCGG + Intronic
1117037234 14:51741831-51741853 TGACATTGTTCCTTATATCCTGG - Intergenic
1117359429 14:54958690-54958712 TGACTTAGTTCCTTCCTCTCTGG + Intronic
1117982462 14:61355688-61355710 TGACTTTATTGGTTGCTTCACGG + Intronic
1119693354 14:76693996-76694018 TGAGTTTCTGCTTTGCTTCCAGG + Intergenic
1120356138 14:83436458-83436480 TCTCTTTGTTCCTTCCTTCATGG + Intergenic
1125196778 15:37056584-37056606 TCGCTTTGTTCCCTGCCTCCGGG - Intronic
1125791051 15:42365889-42365911 TGACTTTATTCCTTGTATTCTGG + Intronic
1127329504 15:57924658-57924680 TCACAGTGTTCCTTGCTTCTGGG - Intergenic
1127716764 15:61655881-61655903 TGGCTTTGGTCCATACTTCCTGG + Intergenic
1128326407 15:66726687-66726709 TGACTCTGTTCCCTGTTTCTTGG + Intronic
1128531194 15:68449259-68449281 TGTTTTTGTTGCTTTCTTCCTGG - Intergenic
1128910397 15:71508477-71508499 TGACTTTGGCCCTTGCCTCTGGG - Intronic
1129727173 15:77907295-77907317 TGACTTTCTGCCTTTCTCCCAGG + Intergenic
1129962105 15:79696799-79696821 TCAGTTGGTTCCTGGCTTCCAGG + Intergenic
1131455724 15:92580924-92580946 TGACTTTGTCCCCTTCTTTCTGG - Intergenic
1131929706 15:97427671-97427693 TGCTTGTGTTCCTTGCCTCCTGG + Intergenic
1131998801 15:98159616-98159638 TCCCTTTGTTCCTTTCCTCCTGG - Intergenic
1132092695 15:98958827-98958849 TGACTTTCTTCCTCTTTTCCCGG + Exonic
1132319746 15:100917565-100917587 TGGCTTTGCTCCTTGCTCCTAGG + Intergenic
1132400102 15:101499837-101499859 TGCCTCTGTGCCTTGCTTCTTGG - Intronic
1133909274 16:10050238-10050260 TGTATTTGTTCCTTGGCTCCTGG - Intronic
1133927682 16:10206306-10206328 TCACCTTGGCCCTTGCTTCCTGG - Intergenic
1134808455 16:17145961-17145983 GGACTTTGTGCCTCCCTTCCAGG + Intronic
1135307663 16:21380813-21380835 TGGCTTTACTCCTTGCTACCTGG + Intergenic
1135830223 16:25766274-25766296 TAACTTTATTCCATGCCTCCTGG - Intronic
1136304407 16:29359933-29359955 TGGCTTTACTCCTTGCTACCTGG + Intergenic
1137568380 16:49548720-49548742 TGACCTTGCTCCTCGCTGCCAGG + Intronic
1137669807 16:50272423-50272445 TGACTGAGATCATTGCTTCCTGG + Intronic
1138480807 16:57301886-57301908 TGACTTTCTTTCCAGCTTCCAGG - Intergenic
1139139601 16:64245020-64245042 TGACTTTGTTTCTTTATTTCTGG - Intergenic
1139492989 16:67296890-67296912 AGACTTAGTCCCTTTCTTCCTGG - Intronic
1139679672 16:68551732-68551754 TAACTTTGTTCGTTGCTTTTTGG + Intronic
1140332526 16:74071753-74071775 TGACTATGTGCCTTGCTTTTGGG - Intergenic
1140723652 16:77792528-77792550 TCCCTCTGTTCCTTGCTTCAAGG - Intronic
1142550897 17:738696-738718 TGCCTGTGTTCCCAGCTTCCTGG - Intronic
1145974253 17:28975255-28975277 TGGCTCTGCTGCTTGCTTCCTGG - Intronic
1148724069 17:49776069-49776091 TGGCTGTGTTACTTCCTTCCTGG - Intronic
1149089481 17:52761619-52761641 TAAGTTTGTGCATTGCTTCCTGG - Intergenic
1149588555 17:57810602-57810624 TGACTATCTTCCTTGCTTCAGGG + Intergenic
1153363566 18:4226816-4226838 TGATTTTGTTACTTGTTTTCTGG - Intronic
1153595398 18:6720256-6720278 TGCCTTTTTTCAGTGCTTCCAGG + Intergenic
1154061956 18:11070683-11070705 TGACTTCCTTCCTTCCTTCTGGG - Intronic
1154296560 18:13155753-13155775 TCATTTTGTTCCTTGTTTTCTGG + Intergenic
1155380829 18:25220161-25220183 TGTCTTCCTTCCTGGCTTCCTGG - Intronic
1156867231 18:41902602-41902624 TGAATATGTTCCTTCCTTCAAGG - Intergenic
1158058119 18:53305806-53305828 TGATTTTCTTCCTGGCATCCAGG + Intronic
1158157528 18:54442606-54442628 TTTCTTTCTTCCTTCCTTCCTGG + Intergenic
1163050608 19:14680586-14680608 TTTCTGTGTTCCTTTCTTCCAGG + Intronic
1164300037 19:23954076-23954098 TGAAATTGTTCCTTGCTTAAAGG + Intergenic
1165652716 19:37505480-37505502 GGGCTTAGTTCCTTGCTACCTGG + Intergenic
1166898194 19:46037110-46037132 TGTCTGTGTACCTTTCTTCCTGG + Intergenic
1167263772 19:48473276-48473298 TGTCTTTGTCCCATCCTTCCAGG + Exonic
1167664195 19:50813894-50813916 TGACTTTATTAATTGCTTCTTGG + Intergenic
1168279946 19:55300165-55300187 TGATTTTGTCCCCTGCTTCATGG + Intronic
925284692 2:2708251-2708273 TGACAGTGTTCCAGGCTTCCAGG - Intergenic
925733259 2:6938049-6938071 TGAATTTGTTCTTTGCTTCCCGG + Intronic
926375507 2:12223713-12223735 GGAGTTGGTGCCTTGCTTCCTGG + Intergenic
926395292 2:12435052-12435074 TGACTCTGTTCTGTGTTTCCTGG + Intergenic
929350033 2:40939565-40939587 TCACTTTGATCTTTGCTTGCAGG - Intergenic
929758816 2:44789458-44789480 TCTTTTTGTCCCTTGCTTCCTGG - Intergenic
931554841 2:63491154-63491176 TGTTTTTGTTTCTTGCTTCATGG + Intronic
932002872 2:67900553-67900575 TGATTTTGTTTCTTGTTTTCTGG - Intergenic
932014185 2:68007720-68007742 TGACTTTGTTTCCTGTTGCCAGG - Intergenic
933516517 2:83310676-83310698 TGACTTAGTTCTTTGGTTCAGGG + Intergenic
934563647 2:95326628-95326650 TGACTCTTTTCCTTGTTCCCCGG + Intronic
942820354 2:180106452-180106474 TTACTTTGATCCTTGCTTAAGGG + Intergenic
943374182 2:187054904-187054926 AGACTTTGTCCTTTGTTTCCTGG + Intergenic
943842577 2:192600708-192600730 TGACATTGTTCCTTCTATCCTGG + Intergenic
943950204 2:194124568-194124590 GGAATTTATTCCTTTCTTCCGGG - Intergenic
947161998 2:227224371-227224393 TGACTTTGTTTTTTTCTACCAGG + Intronic
947744400 2:232500114-232500136 TCCCTCTGTCCCTTGCTTCCCGG - Intergenic
1168773973 20:433347-433369 CGAGTGTGTTCCTTCCTTCCTGG - Intergenic
1173691139 20:44962043-44962065 TGACTTCCATCTTTGCTTCCAGG + Intergenic
1174687002 20:52465638-52465660 TGACTGTGTTCCTTGTTTCAAGG - Intergenic
1176898550 21:14413332-14413354 TGACTTTCTGTCTTGCTTCCAGG - Intergenic
1178199533 21:30388100-30388122 AGACATTGTTCCTATCTTCCAGG + Intronic
1178264864 21:31133493-31133515 TTACTCTGTTCCCTGCCTCCTGG - Intronic
1178514748 21:33237029-33237051 TGGCTTCCTTCCTTGCTTTCTGG - Intronic
1178929502 21:36805338-36805360 GCACTGTCTTCCTTGCTTCCAGG + Intronic
1179314402 21:40228835-40228857 TGGCATTGTTCCTTGCTTCCAGG + Intronic
1179339750 21:40494154-40494176 TCACTTTGTTACTGGCTTTCTGG - Intronic
1179431529 21:41324516-41324538 TCACTATGTTCTTTACTTCCTGG + Intronic
1179462189 21:41543916-41543938 TGTCTTCCTTCCTTTCTTCCGGG - Intergenic
1181756316 22:25027558-25027580 TGACTTCGCCTCTTGCTTCCTGG + Intronic
1185040097 22:48499536-48499558 TGACTCTGGTCCCTGGTTCCTGG + Intronic
1185154455 22:49184740-49184762 TGATTTTGTTGCTTGATGCCAGG - Intergenic
949579042 3:5368111-5368133 TGCTTTTCTACCTTGCTTCCTGG + Intergenic
949801486 3:7909311-7909333 TGTCTTTGTTTCTACCTTCCTGG - Intergenic
949896570 3:8771399-8771421 TGCCTTTTTTCTTTGCTTCCTGG - Intronic
950446534 3:13042005-13042027 TTTCATTGTTCCTTGCTGCCGGG - Intronic
950892413 3:16415725-16415747 TTCCTTGCTTCCTTGCTTCCAGG - Intronic
951307010 3:21076536-21076558 TGCCTGTGTTCCTTGGTTCCTGG + Intergenic
952944547 3:38469035-38469057 TGGCTTGGTTCCTTGTTTCTAGG + Intronic
954521080 3:51227261-51227283 TTATTTTGTTTCTTTCTTCCAGG + Exonic
954886415 3:53878442-53878464 TGTCTTTGTTCATTACTTTCTGG + Exonic
955638968 3:61061305-61061327 GGACTTTGTGCCTTGGTTACAGG + Intronic
955997778 3:64695168-64695190 TGACTTTGGTCCCTGCATCAAGG + Intergenic
956090890 3:65665965-65665987 TGGCTTATATCCTTGCTTCCAGG + Intronic
956651938 3:71512352-71512374 TGGCTTTTTACCTTGCTTACAGG - Intronic
957077367 3:75612378-75612400 TGACATTGTTCCTTCTATCCTGG - Intergenic
957463155 3:80549108-80549130 TAAGATTGTTCCATGCTTCCTGG + Intergenic
958668852 3:97176639-97176661 GGAATTTGTTCATTTCTTCCAGG + Intronic
958756613 3:98257031-98257053 GGAATTTGTTCATTTCTTCCAGG + Intergenic
958757445 3:98267329-98267351 GGAATTTGTTCATTTCTTCCAGG + Intergenic
959155010 3:102656496-102656518 TGACTTTGTACTCTGTTTCCTGG + Intergenic
959433460 3:106284119-106284141 TGACTTTATTTCCTGCATCCTGG - Intergenic
959535245 3:107477374-107477396 TGACTCTGTCCATTGCTTCTGGG + Intergenic
962951283 3:140221516-140221538 TCACTTTGTTGTTTGTTTCCTGG - Intronic
967632333 3:191759608-191759630 GGACTTTCTTCCTGGCTTGCAGG - Intergenic
968707522 4:2087130-2087152 TGACTTTATCCCTTTCTGCCGGG - Intronic
969731149 4:8958853-8958875 TGACATTGTTCCTTCTATCCTGG + Intergenic
969790775 4:9493040-9493062 TGACATTGTTCCTTCTATCCTGG + Intergenic
971152592 4:24049654-24049676 TAACTTTGCTCCTTGCCTCATGG + Intergenic
971680842 4:29698443-29698465 TGTCCTTCTTCCTTTCTTCCTGG + Intergenic
971753593 4:30680744-30680766 TGACTTTCTGCCTTCCTTCCTGG - Intergenic
972351745 4:38242628-38242650 TGACTTTTTACCTTTCTTGCAGG + Intergenic
974600897 4:64077834-64077856 CAACTTTTTTCCTTGCCTCCTGG - Intergenic
974652449 4:64772593-64772615 TCACTTTGTTTATTACTTCCTGG - Intergenic
975551243 4:75615233-75615255 TGACTTTGTTCCAGGCTAGCAGG - Intronic
976468786 4:85402493-85402515 TGTCTCTGTTCCTTGAGTCCAGG - Intergenic
976929749 4:90551396-90551418 TGACTCTGGTTCTTGCTTGCAGG + Intronic
977308229 4:95351985-95352007 TCCCTTTCTTCCTTGCTGCCTGG + Intronic
977712724 4:100145963-100145985 TGACTCTGTGACTTGCATCCTGG - Intergenic
978957970 4:114638322-114638344 TGACCCTGTTCCTTACTCCCAGG - Intronic
980469600 4:133234160-133234182 TGATTATGTTCCTTGCAGCCTGG + Intergenic
981678949 4:147372204-147372226 GGGCTTTCTTCCTTGCTTGCAGG - Intergenic
982095125 4:151915062-151915084 TGAATTTGTTCCTCAGTTCCAGG + Intergenic
982996021 4:162346731-162346753 GGACTGTGTTCCCTGTTTCCTGG - Intergenic
983340475 4:166454658-166454680 AGACTTGGTGCCTTGCATCCCGG + Intergenic
983573320 4:169233687-169233709 TGATTTTCTTCATTGCCTCCAGG + Intronic
984124387 4:175788350-175788372 TGACTGTTTTCCTTGATTTCAGG - Intronic
985614592 5:911811-911833 TGACTGTGGTGCTTGCTTCTCGG + Intronic
986902765 5:12457434-12457456 TGATTATCTTCCTTTCTTCCTGG - Intergenic
988111534 5:26828563-26828585 TGGCTTTCTTTCTTTCTTCCAGG + Intergenic
988615491 5:32770987-32771009 TGACCTTGTTCCTTTCAGCCTGG + Intronic
988909777 5:35827481-35827503 TGGCTTTGCTCCCTGCTTTCAGG - Intergenic
988935610 5:36079566-36079588 AGGCTTTGTTCTTTGGTTCCCGG + Intergenic
989521880 5:42412118-42412140 TGATTTTGTTCCTCTCTACCAGG + Intergenic
989768144 5:45110656-45110678 TGACTATGTTTTTTGCTTTCTGG - Intergenic
991424148 5:66473333-66473355 TGAGTTTTTTCCCTGCTTCTAGG - Intergenic
991469337 5:66951337-66951359 TGACCTTATTCCTTGCCTCCTGG + Intronic
992211756 5:74486846-74486868 TGTCTTTGTTCCTTTCCTCTGGG - Intergenic
992467688 5:77023326-77023348 TGAGGTTGTTCGTTGCTTGCTGG - Intergenic
993134825 5:83946705-83946727 TTACTTTGTTCCATGATCCCTGG - Intronic
994518565 5:100800206-100800228 TAACTCTTTTCCTTGCCTCCTGG - Intergenic
996720415 5:126624553-126624575 TAACTTTGTTCCTTTATTACAGG + Exonic
996762328 5:126998878-126998900 TTACTTTGTTCCTTGACTTCGGG - Intronic
996855301 5:127999075-127999097 GAACTGTCTTCCTTGCTTCCTGG + Intergenic
997635859 5:135405119-135405141 GGGCTTTCTTCCTTTCTTCCTGG + Intergenic
997684439 5:135778857-135778879 TGACATTGTTCCTTATATCCAGG + Intergenic
997791098 5:136763115-136763137 TGACTTTTGACCTTTCTTCCTGG - Intergenic
998517294 5:142768204-142768226 TGTCTTTTTTCCTTGCCTGCTGG + Intergenic
998750613 5:145317742-145317764 TGACTTTGTCCCTGGGCTCCAGG + Intergenic
998919951 5:147057112-147057134 TGACTTTGTTTTTTCCCTCCTGG - Intronic
998935689 5:147229805-147229827 TGATATTGTTCCTAGCATCCAGG - Intergenic
999382841 5:151133715-151133737 TGCCTTTCTTCCTTTCTTTCTGG + Intronic
1000896505 5:166861654-166861676 TGACATTGTTACTTTCTGCCAGG + Intergenic
1003075612 6:2981406-2981428 TGGCTTTGCTCCCTGCTCCCTGG + Intergenic
1003616684 6:7660799-7660821 TTGCTTTTTTCATTGCTTCCAGG + Intergenic
1004277148 6:14247726-14247748 TGACTTTCTTTCTTGATTCAAGG + Intergenic
1004430295 6:15536877-15536899 TGACTTCATGCCTTACTTCCAGG - Intronic
1004451570 6:15752855-15752877 TGATGCTGTACCTTGCTTCCTGG + Intergenic
1005143172 6:22657672-22657694 TGATTTTTTTTCTTGCTTCTTGG + Intergenic
1005153771 6:22780606-22780628 AGCCATTGTGCCTTGCTTCCTGG - Intergenic
1006875170 6:37289212-37289234 TTACTTAGTTCTTTGCTTCTTGG - Intronic
1008434224 6:51456321-51456343 TGACTTGTTTACATGCTTCCAGG - Intergenic
1009027372 6:58016091-58016113 TGTCTTTGTTCCTCTCCTCCAGG - Intergenic
1009049720 6:58262096-58262118 TAACATTGTTCCTAACTTCCAGG - Intergenic
1009202911 6:60767574-60767596 TGTCTTTGTTCCTTTCCTCCAGG - Intergenic
1011755691 6:90496398-90496420 TGTCTTCTTTCCTTTCTTCCGGG + Intergenic
1012307886 6:97681996-97682018 TGTCTTTCTTCTTGGCTTCCAGG + Intergenic
1013026156 6:106274124-106274146 TGACTTAGTTTCTTGCTTTTCGG - Intronic
1013913913 6:115311231-115311253 TCACTTTGTTAGTTGTTTCCTGG + Intergenic
1014129554 6:117815206-117815228 TGGCTCTGTCCCCTGCTTCCTGG + Intergenic
1014629558 6:123772234-123772256 TACCTCAGTTCCTTGCTTCCTGG + Intergenic
1014760344 6:125349390-125349412 TAAATGTGTTCATTGCTTCCAGG + Intergenic
1014990121 6:128064676-128064698 GGACTTTGTTCCCTGCTTCAGGG - Intronic
1016159021 6:140852808-140852830 TGAATTTGTACCTGGCTTCTTGG + Intergenic
1018107194 6:160500242-160500264 TGCCTTTGCTCTTTTCTTCCTGG + Intergenic
1018873873 6:167803498-167803520 TGACTTTGTTCTTCTCTGCCTGG - Intergenic
1019502754 7:1373093-1373115 AGACCTTTTTCTTTGCTTCCTGG - Intergenic
1020006333 7:4785393-4785415 TGACTTTTTCCCCTCCTTCCAGG + Exonic
1020014980 7:4825542-4825564 TTTCTTTCTTCCTTTCTTCCTGG - Intronic
1020307859 7:6848385-6848407 TGACATTGTTCCTTCTATCCTGG - Intergenic
1021971669 7:25971090-25971112 TAACTTTGTTCTTTTCTGCCAGG - Intergenic
1022046520 7:26626558-26626580 TGAGTGTGTTCCATTCTTCCTGG - Intergenic
1022245988 7:28559818-28559840 AGGCTGTGTTCCTTTCTTCCTGG + Intronic
1023577570 7:41645648-41645670 TGAGGTTGTTTATTGCTTCCTGG - Intergenic
1023611372 7:41974757-41974779 TTACTATGTTCCATGCATCCTGG - Intronic
1026645564 7:72165149-72165171 TGAACTTGTTCTTTGCTACCAGG - Intronic
1027611065 7:80361140-80361162 TGATTCTGTTCCTTGATTGCCGG + Intergenic
1028306202 7:89268535-89268557 TAGCTTTGTGCCTTGCTGCCTGG - Intronic
1029027212 7:97429484-97429506 TGACCTTTTTCCCTCCTTCCTGG + Intergenic
1030149486 7:106388814-106388836 TGACTTGATTCCTGGCTTTCAGG + Intergenic
1030518752 7:110570129-110570151 TCACTTTGTCGCTTTCTTCCAGG - Intergenic
1030602363 7:111607114-111607136 TGACTTTGTTTGTTTCTTGCTGG - Intergenic
1031038105 7:116810004-116810026 TGCCTTTGTTGCTTGCCACCTGG + Intergenic
1031543005 7:123018167-123018189 TGGCTTTGTTTCTTGCTCCTTGG + Intergenic
1031580537 7:123468758-123468780 TGAGTTTGTTTCTTGTTTCTTGG + Intronic
1031927598 7:127652623-127652645 TCCCCTTGTTCCTTGCCTCCCGG + Intronic
1032536066 7:132665532-132665554 AAACTTTTTTTCTTGCTTCCTGG + Intronic
1033501066 7:141950247-141950269 TGACTTTCTTCCCTTCTCCCTGG + Intronic
1034187884 7:149193163-149193185 TGATTTCCTTCCCTGCTTCCTGG - Intergenic
1035881055 8:3244476-3244498 GGACCTTATTCCTTTCTTCCTGG - Intronic
1037196569 8:16198107-16198129 TGACTGTGTTCATTTTTTCCAGG + Intronic
1037522975 8:19697927-19697949 TGATCTTCCTCCTTGCTTCCTGG - Intronic
1037859247 8:22393000-22393022 TAATTTTGTTCCCTGCTTCTGGG + Intronic
1038852034 8:31288822-31288844 TGCCTTTGTTACTGGCTGCCTGG + Intergenic
1039976272 8:42368115-42368137 TGGCTTTGTTCCTTTCCTCAAGG - Intronic
1041036722 8:53799051-53799073 TGACTTTGATTCTTTCTTACAGG + Intronic
1041854838 8:62439447-62439469 TAACTTGCTTTCTTGCTTCCAGG - Intronic
1043294709 8:78648191-78648213 TGAAATTGTTCCTTGCTTAAAGG - Intergenic
1043534612 8:81188735-81188757 TGAGTTTTTACCTTGTTTCCTGG - Intergenic
1044102869 8:88162319-88162341 TGACTTTTTTCCTTTTTTCCTGG - Intronic
1045729061 8:105213246-105213268 TGATTTTGGTGATTGCTTCCTGG - Intronic
1048346766 8:133581712-133581734 TGACGTAGTTCCTTGCCTCAGGG + Intergenic
1048417417 8:134242928-134242950 GGACTTTGTCTCTTACTTCCTGG - Intergenic
1048503148 8:134996818-134996840 TGACTTTGTTCCTTGCCCATGGG - Intergenic
1049151665 8:141038863-141038885 TGACTTGGTTCCTGCCTTCAAGG + Intergenic
1049523102 8:143104846-143104868 TGACACTGTTCCTTCATTCCGGG - Intergenic
1049695230 8:143980713-143980735 TGACTTTCTTCATTTTTTCCAGG - Intronic
1050811686 9:9756302-9756324 TGACTTTGATCCACACTTCCTGG + Intronic
1050902687 9:10966464-10966486 TGACATTGTTCCTTATATCCTGG + Intergenic
1050987455 9:12101696-12101718 TGACTTTCTGCCTGGCTTTCAGG - Intergenic
1052084974 9:24253927-24253949 TCACTTTGTTCCTTTCCTCCTGG + Intergenic
1052689879 9:31803259-31803281 TCATTTTGTTACTTGCTTTCTGG - Intergenic
1053443963 9:38137153-38137175 TGACTTTGGTCTTTGCTGCAAGG - Intergenic
1053737556 9:41111112-41111134 TGACATTGTTCCTTATATCCTGG + Intergenic
1053738225 9:41115478-41115500 TGACATTGTTCCTTATATCCTGG + Intergenic
1054690127 9:68315840-68315862 TGACATTGTTCCTTATATCCTGG - Intergenic
1054690795 9:68320207-68320229 TGACATTGTTCCTTATATCCTGG - Intergenic
1056262721 9:84864654-84864676 TGACTCCCTTCCTTGGTTCCCGG - Intronic
1056337128 9:85583095-85583117 TGTCTGTGTTCCTTGCATCATGG - Intronic
1056787415 9:89603288-89603310 TGGCTTTGTTCCTTTCATTCAGG - Intergenic
1059733507 9:117079228-117079250 TGACTGTGGTCCTAGCTTCTTGG + Intronic
1059831646 9:118102673-118102695 TGACTTTCTTCCTATCTTACAGG + Intergenic
1186016568 X:5201547-5201569 TGACTGGGTTCTCTGCTTCCTGG - Intergenic
1186345886 X:8692647-8692669 TGAGCATGTTCCTTTCTTCCAGG - Intronic
1186715534 X:12247270-12247292 TGATTTTGCTCCTCTCTTCCAGG - Intronic
1187476149 X:19612850-19612872 TGTCCTTGTTCTCTGCTTCCAGG - Intronic
1187581597 X:20612973-20612995 TGACTCTGCTCCTTGAATCCAGG - Intergenic
1187948124 X:24446271-24446293 TGCCTGTGTTCCTTGGCTCCTGG - Intergenic
1188579411 X:31691388-31691410 TCATTTTGTTCATTGTTTCCTGG - Intronic
1192507769 X:71699661-71699683 TGAAATTGTTCCTTGCTTAAAGG - Intergenic
1192518927 X:71781891-71781913 TGAAATTGTTCCTTGCTTAAAGG + Intergenic
1193945277 X:87726109-87726131 TGACTTTGTTTCTCTCTGCCTGG - Intergenic
1195304539 X:103567219-103567241 TGACTTAGTACCTGGCTTTCAGG + Intergenic
1197113939 X:122809309-122809331 TGCCTTTGTTCCTAGATTTCTGG - Intergenic
1198270807 X:135054477-135054499 TGTCTTTCTTCCTTCTTTCCTGG + Intergenic
1199250843 X:145659887-145659909 TGACTCCATTTCTTGCTTCCAGG - Intergenic
1201062257 Y:10057904-10057926 TCACTTTATTACTTGCTTACAGG + Intergenic
1201421061 Y:13799503-13799525 TGAGCATGTTCCTTTCTTCCAGG + Intergenic