ID: 914237279

View in Genome Browser
Species Human (GRCh38)
Location 1:145823705-145823727
Sequence TGGCCCCGATTTCCCGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 3, 1: 0, 2: 1, 3: 0, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914237279_914237282 -10 Left 914237279 1:145823705-145823727 CCAGTTCCGGGAAATCGGGGCCA 0: 3
1: 0
2: 1
3: 0
4: 42
Right 914237282 1:145823718-145823740 ATCGGGGCCAGGAATCTATGAGG 0: 3
1: 0
2: 0
3: 2
4: 64
914237279_914237286 24 Left 914237279 1:145823705-145823727 CCAGTTCCGGGAAATCGGGGCCA 0: 3
1: 0
2: 1
3: 0
4: 42
Right 914237286 1:145823752-145823774 AGAGAACACAGCGCTCTTACCGG 0: 3
1: 0
2: 1
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914237279 Original CRISPR TGGCCCCGATTTCCCGGAAC TGG (reversed) Intronic
914203352 1:145505783-145505805 TGGCCCCGATTTCCCGGAACTGG - Intergenic
914237279 1:145823705-145823727 TGGCCCCGATTTCCCGGAACTGG - Intronic
914482474 1:148078937-148078959 TGGCCCCGATTTCCCGGAACTGG - Intergenic
1071335133 10:84594278-84594300 TGGCCCCAAGTTCCCGGAGTGGG + Intergenic
1074919531 10:117993260-117993282 TGCCCTCTATTTCCCTGAACTGG - Intergenic
1075781983 10:125023008-125023030 TGGCCTCGGTTTCCAGCAACTGG - Intronic
1082166400 11:48955592-48955614 TGCCCCCCACTTCCCGGAAGGGG + Intergenic
1100558395 12:95721353-95721375 TGGCCCCAATTTCCCACACCTGG + Intronic
1113627407 13:111857052-111857074 TGGCGTGGATTTCCCGGGACTGG - Intergenic
1119538128 14:75419534-75419556 TGGCCCGGATTGCCTGGAGCTGG + Intergenic
1121244025 14:92449831-92449853 TGGCCCCCTTGTCCGGGAACTGG + Intronic
1122370018 14:101224533-101224555 TGACCCCGAGCTCCCGGAGCTGG - Intergenic
1122976061 14:105171244-105171266 TGGCATTGATTTCCCGGCACTGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1128789690 15:70423860-70423882 TGGGCCCCATTGCCCAGAACAGG + Intergenic
1132770318 16:1558611-1558633 GAGCACCGATTTCCAGGAACTGG - Intronic
1135412186 16:22243594-22243616 TGGCCCGGATATCAGGGAACGGG - Intronic
1143504675 17:7356992-7357014 TGCCCCCGCTTTCCCGGAACAGG - Exonic
1146724823 17:35148388-35148410 TGGCCACGCTTTATCGGAACCGG + Exonic
1152353225 17:79794826-79794848 GGGCCCCCATGTCCCGGTACAGG + Exonic
1153765133 18:8367511-8367533 TGGCCGCGCTTCCGCGGAACAGG - Intronic
925156338 2:1651363-1651385 TGGCCCCAGTTTCCCAGGACTGG + Intronic
1181805151 22:25370100-25370122 TGGCTCAGAGTTCCAGGAACGGG - Intronic
952523590 3:34186492-34186514 TGGCCACCTTTTCCCAGAACAGG - Intergenic
952699245 3:36308154-36308176 TGGCCCTCATTTCTCTGAACAGG - Intergenic
953396991 3:42581628-42581650 TGGCCCCGGGGTCCGGGAACAGG + Intronic
955736174 3:62040796-62040818 TAGCCCCGATGTCCCTGACCAGG - Intronic
956589782 3:70902463-70902485 TGGCTCAGATTTCCCTCAACAGG + Intergenic
963888901 3:150611790-150611812 CAGCCCCGATTTCCCGGACGAGG + Intronic
964919194 3:161875422-161875444 TGGCCCCGAGTTCTCTGCACAGG - Intergenic
969433102 4:7167488-7167510 TTGCCCTGTTTTCCAGGAACAGG + Intergenic
994182763 5:96785435-96785457 TGGCCCCGCTATACCGGATCAGG - Intronic
1002534830 5:179870372-179870394 TGGCAAAGAGTTCCCGGAACTGG + Exonic
1002644251 5:180645457-180645479 TGGCCCCGATTTAGCAGCACTGG - Intronic
1003427821 6:6009008-6009030 CGGCCCAGCTTTCCCGGACCAGG + Intergenic
1019358090 7:591362-591384 TGACCCCCATTTCCAGGTACAGG + Intronic
1020080372 7:5283210-5283232 TGGCCTCGGGTTCCCGGGACAGG - Intronic
1025198543 7:56948969-56948991 TGGCCTCGGGTTCCCGGGACAGG + Intergenic
1025673408 7:63627964-63627986 TGGCCTCGGGTTCCCGGGACAGG - Intergenic
1029535568 7:101155351-101155373 TGGCCCAGACCCCCCGGAACTGG + Intronic
1031738407 7:125396625-125396647 TTGCCCAGATTGCCCAGAACAGG + Intergenic
1034202126 7:149289306-149289328 TGGCCCTGATTTTCTGGACCTGG - Intronic
1037947174 8:22996844-22996866 TGGCCCTGTTTTCCAGGATCTGG + Intronic
1043418935 8:80079349-80079371 TGGCTGGGATTTCCAGGAACAGG - Intronic
1188263221 X:28041380-28041402 TGGCCCCGATTTCACAGAGTTGG - Intergenic
1195668223 X:107449483-107449505 TGGCGTCGATTTCCCCGAATGGG - Intergenic