ID: 914237462

View in Genome Browser
Species Human (GRCh38)
Location 1:145824559-145824581
Sequence TACTGAGGCGGGGTGGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914237451_914237462 15 Left 914237451 1:145824521-145824543 CCAAAGATATGTGGATGGACGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 914237462 1:145824559-145824581 TACTGAGGCGGGGTGGGGACGGG 0: 1
1: 0
2: 2
3: 25
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914237462 Original CRISPR TACTGAGGCGGGGTGGGGAC GGG Intronic
900116518 1:1031517-1031539 GACTGGGGCTGGGTGGGGCCAGG + Intronic
900121150 1:1049175-1049197 CAGGTAGGCGGGGTGGGGACGGG + Intronic
900243729 1:1628468-1628490 CCCTGGGGAGGGGTGGGGACGGG - Exonic
900367486 1:2317140-2317162 TAGAGAGACGGGGTGGGGATGGG - Intergenic
900373121 1:2341084-2341106 GACCGAGGTGGTGTGGGGACCGG - Intronic
900517594 1:3090378-3090400 CCCTGAGGCTGGGTGGGGATTGG + Intronic
900530514 1:3150851-3150873 TATGGAGGCCGGGTGGGGGCGGG + Intronic
900555816 1:3279787-3279809 GCCTGCGGGGGGGTGGGGACAGG + Intronic
900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG + Intronic
901018448 1:6244451-6244473 GACTCAGGCGGGGTGGGGGTGGG + Intronic
901272250 1:7961584-7961606 GACTGAGGCGGGGGTGGCACCGG - Intronic
901658217 1:10782729-10782751 CACTGAGGCGGGAAGGGGAGTGG + Intronic
901758037 1:11453290-11453312 TACAGAGGCTGGCTGGGGGCTGG - Intergenic
902229972 1:15021628-15021650 TCCTGAGCCGGGGTGGTGGCAGG + Intronic
902536210 1:17120433-17120455 AACTGAGGGGGGGTGGGCAGAGG + Intergenic
902719201 1:18292825-18292847 CTCTGAGGAGGGGTGGGTACTGG - Intronic
903047179 1:20573530-20573552 GACTGGGGTGGGGTGGGAACAGG + Intergenic
903983590 1:27208124-27208146 GACTGTGGTGGGGTGGGGGCAGG - Intergenic
904482957 1:30805516-30805538 AACTGAGGCGGGGGTGGGAAGGG + Intergenic
904769100 1:32870990-32871012 TGCGGGGGCGGGGTGAGGACCGG + Intronic
904805362 1:33127529-33127551 GACTGAGGCGGCGTGGGAAGCGG + Intergenic
905226504 1:36482553-36482575 CACTGAGCTGGGCTGGGGACAGG - Intronic
905233555 1:36530285-36530307 GACTGAGGCAGGGCGGGGGCGGG - Intergenic
905626829 1:39495001-39495023 TACTGAGGCTGGGTGGGGCGGGG + Intronic
905915905 1:41684131-41684153 TCATGAGGGGAGGTGGGGACAGG + Intronic
905968056 1:42116036-42116058 CAGGGAGGCGGGGTGGGGAGTGG + Intergenic
906309166 1:44740710-44740732 CAGTGAGGTGGGCTGGGGACAGG - Intronic
906479286 1:46189641-46189663 TTCTGAGGAGGGGTGGGGGCTGG - Intronic
907517067 1:54999372-54999394 TAGTGGGGCTGGGTGGGGCCAGG + Intronic
908221414 1:62010434-62010456 GGCTGGGGCGGGGTGGGGAGGGG - Intronic
908465877 1:64394629-64394651 CACTGGGGCAGGGTGGAGACTGG - Intergenic
908974601 1:69882762-69882784 TACTGTGGTGGGGTGGGGGGCGG - Intronic
909559996 1:76999639-76999661 GACTGTGGTGGGGTGGGGGCAGG - Intronic
910388006 1:86705179-86705201 AAGCGAGGCGGGGTGGGGACGGG + Intronic
911811629 1:102290027-102290049 TACTGGGGCCTGTTGGGGACTGG - Intergenic
912536040 1:110371869-110371891 TACAGAGGAGGTGTGGGGACCGG + Intronic
913472348 1:119201807-119201829 ACCTGATGGGGGGTGGGGACTGG + Intergenic
913682731 1:121202317-121202339 AAGTGAGGAGGGGAGGGGACAGG - Intronic
914034573 1:143989943-143989965 AAGTGAGGAGGGGAGGGGACAGG - Intergenic
914154879 1:145078025-145078047 AAGTGAGGAGGGGAGGGGACAGG + Intronic
914237462 1:145824559-145824581 TACTGAGGCGGGGTGGGGACGGG + Intronic
917033497 1:170721120-170721142 TTGGGAGGCGGGGTGGGGAGTGG - Intronic
917508542 1:175650716-175650738 TAATGAGGCGGGGAGGGGTAGGG - Intronic
920007652 1:202845081-202845103 GACTGGGGAGGGGTGGGGAAAGG + Intergenic
920258697 1:204674304-204674326 TAGTGAGGAGGGGAGGGGAGGGG - Intronic
920347118 1:205313637-205313659 CTCTGAGAAGGGGTGGGGACTGG - Intronic
920470043 1:206220831-206220853 AAGTGAGGAGGGGAGGGGACAGG - Intronic
920850105 1:209622951-209622973 AGCCGAGGCGGGGTGGGCACAGG - Intronic
921708709 1:218352128-218352150 TAATGGGGCGGGGTGGGGTGGGG - Intronic
922292624 1:224221138-224221160 TACTTAGGGGGGGTGGTGGCTGG - Intergenic
924495435 1:244584374-244584396 TACTGAGACTGGGAGGGGAAAGG + Intronic
924620280 1:245654300-245654322 TAATGATGAGGGGTGGGGAGGGG + Intronic
1063154956 10:3370615-3370637 CAGTGGGGCGGGGTGGGGGCGGG - Intergenic
1065829895 10:29605366-29605388 TGCTGAGGCTGGGGGGAGACGGG - Intronic
1066522951 10:36243185-36243207 TACTCAGCTGGGGTGGGGAAAGG + Intergenic
1068339446 10:55683222-55683244 GACTGTGGTGGGGTGGGGAGAGG - Intergenic
1068975807 10:63007825-63007847 TACTGAGGTGAGGTGGGGTGGGG + Intergenic
1069708326 10:70473220-70473242 TGCAGAGTCGGGGTGGGGCCAGG - Intergenic
1069981469 10:72255580-72255602 TAAGGAGGTGGGGTGGGGGCTGG - Intergenic
1070272310 10:74968124-74968146 CACTGAAGCGGGGAGGGGAGAGG - Intronic
1070796759 10:79221450-79221472 TACTGAGGAGGGAGGGGGCCTGG - Intronic
1070802581 10:79252191-79252213 TACATAGGCTGGGTGGGTACAGG - Intronic
1070811881 10:79302211-79302233 AAGTGAGTCAGGGTGGGGACGGG + Exonic
1073120962 10:101122377-101122399 TGTTCAGGCGGGGTGGGCACGGG - Intronic
1073139356 10:101237261-101237283 TAGGGAGGCTGAGTGGGGACAGG - Intergenic
1074560925 10:114534490-114534512 CCCTGAGGCGGGGTGGGGGTGGG + Intronic
1074668987 10:115765971-115765993 TAGTGAGCCGGGGGGGGGAAAGG - Intronic
1075098477 10:119489594-119489616 GAGTGGGGCGGGGTGGGGGCGGG + Intergenic
1075414269 10:122250625-122250647 TACTTAGGTGGAGTGAGGACTGG - Intronic
1076260641 10:129062398-129062420 TACTGAGGCTGGGACAGGACAGG + Intergenic
1076385314 10:130051449-130051471 TAATGAGGCGGGGGCGGGAGAGG - Intergenic
1076605739 10:131688987-131689009 AGCTGAGGCGGGGGGTGGACAGG - Intergenic
1076729656 10:132432030-132432052 CAGTGATGCAGGGTGGGGACAGG + Intergenic
1076735566 10:132457527-132457549 TGCTGAGGTGGGTTGGGGGCTGG - Intergenic
1076795362 10:132795500-132795522 TAGTGGGGAGGGGTGGGGGCTGG + Intergenic
1077439703 11:2562178-2562200 ACCTTGGGCGGGGTGGGGACTGG + Intronic
1079127607 11:17730199-17730221 TAAGGAGGCTGGGTGGGTACAGG - Intergenic
1079450843 11:20598622-20598644 TACTGTGGCGGGGATGGGAGTGG - Intergenic
1079895484 11:26113925-26113947 CAGTGAGGCTGGGTGGGGAGGGG + Intergenic
1080388638 11:31825113-31825135 GCCTGGGGCGGGGTGGGGGCTGG - Intronic
1081829049 11:46090639-46090661 TATTGAGGTGGGGTGGGGGTGGG - Intronic
1081981664 11:47270394-47270416 TGCCGAGGAGGGGCGGGGACGGG + Intronic
1082022185 11:47543742-47543764 TTTAGAGACGGGGTGGGGACAGG - Intronic
1083059599 11:59856060-59856082 TAATGAGGCAGGGTGGGGTGGGG + Intronic
1083883930 11:65561664-65561686 TACTGAGGCGGCGGTGGGAGGGG - Intergenic
1085021528 11:73213208-73213230 GGCTGAGGAGGAGTGGGGACAGG + Intergenic
1085238357 11:75032229-75032251 TCCTGAGGTGGGATGGGGAAAGG + Intergenic
1089400269 11:118160396-118160418 TGCTGATGGGGGGTGGGAACAGG + Intergenic
1090223836 11:125056481-125056503 GTCAGAGGCGGGGTGGGGGCTGG + Intergenic
1090552494 11:127838287-127838309 TGCTGAGGAGGGGTGGGGCCAGG - Intergenic
1091304637 11:134529733-134529755 TGGAGAGGCGGGGTGGGGAATGG + Intergenic
1091680745 12:2524870-2524892 GACTGGGGCTGGGTGGGCACAGG + Intronic
1092575863 12:9782068-9782090 CACTGGGGGGGGGTGGGCACTGG + Intergenic
1093316357 12:17656127-17656149 GACTGTGGCGGGGTGGGGGGAGG - Intergenic
1093928214 12:24929732-24929754 TATTGAGGGGAGGTGGTGACAGG - Intronic
1095251503 12:39984171-39984193 GACTGTGGTGGGGTGGGGGCAGG + Intronic
1096109523 12:49020677-49020699 TAGTGAGGCAGGGTGTGGCCCGG - Exonic
1096195114 12:49644689-49644711 TACTGGGGCAGGCTGGGGACTGG + Exonic
1096493076 12:52023556-52023578 GATGGAGGCGGGGTGGGGGCGGG - Intronic
1096566492 12:52486271-52486293 TACTGAAGTGGCCTGGGGACAGG + Intergenic
1096578518 12:52569706-52569728 TACCGAGGCAGGGTGGGAAAGGG + Intronic
1096840472 12:54376706-54376728 TGCTGACCCAGGGTGGGGACAGG - Intronic
1096941476 12:55350103-55350125 GACTGTGGTGGGGTGGGGGCAGG + Intergenic
1097224922 12:57471463-57471485 TACTGTGGGAGGGTGGGGGCAGG + Exonic
1097227734 12:57488436-57488458 TACTGGGGTGAGGCGGGGACCGG - Intronic
1097980150 12:65729553-65729575 AACTGAGACTGGGTGGGGAAAGG + Intergenic
1098198424 12:68027426-68027448 AATTGAGGGGTGGTGGGGACTGG + Intergenic
1098801217 12:74960588-74960610 CACAGAGTCGGGGTGGGGGCAGG + Intergenic
1099640601 12:85279731-85279753 CATGGGGGCGGGGTGGGGACGGG + Intergenic
1100687911 12:97006810-97006832 TACGGAGGTGGGGTTTGGACAGG + Intergenic
1103085840 12:118061235-118061257 AACGGAGGGGGGGTGCGGACGGG + Intronic
1103698328 12:122835012-122835034 TTCGGAGGAGGGGTGGGGAGAGG + Intronic
1104771693 12:131367931-131367953 GACAGAGGCTGGGTGGGGAGTGG - Intergenic
1106032064 13:26012724-26012746 TGCTGACGGGGGGTGGGGGCGGG + Intronic
1106098111 13:26668379-26668401 TACAGAGGTGGGGAGAGGACAGG - Intronic
1108667361 13:52645940-52645962 TACTGGGTGGGGGTGGGGGCTGG - Intergenic
1111906997 13:94266531-94266553 GACTGAGGGAGGGTGGGGAAGGG - Intronic
1112507887 13:99985707-99985729 TGCTGCGCTGGGGTGGGGACAGG - Exonic
1113591254 13:111502918-111502940 GACTCAGGCAGGGTGGGGAGTGG + Intergenic
1114463033 14:22900336-22900358 TAGTGGGGCGGGGCGGGGAGGGG - Intergenic
1114771305 14:25430729-25430751 CAGTGAGGCGGGGTGGGGGTGGG + Intergenic
1116770862 14:49125518-49125540 AGCAGAGGAGGGGTGGGGACAGG + Intergenic
1116908899 14:50436384-50436406 TAATGATTCAGGGTGGGGACTGG + Intronic
1117066748 14:52019075-52019097 CAGTGAGGCGGGGTGGAGCCAGG + Exonic
1118315432 14:64723021-64723043 TGCTGAGGCGTAGTGGGGAGGGG + Intronic
1118485007 14:66206447-66206469 GACTGTGGTGGGGTGGGGAGAGG + Intergenic
1120008314 14:79385208-79385230 GACTGTGGTGGGGTGGGGGCGGG - Intronic
1121736129 14:96219405-96219427 CACAGGGGAGGGGTGGGGACCGG + Intronic
1122093582 14:99355232-99355254 TACGGTGGCAGAGTGGGGACAGG - Intergenic
1122411596 14:101528661-101528683 GACTGAGGCAGGGTGGGGGCAGG + Intergenic
1122417669 14:101558108-101558130 GAGAGAGGCGGGGAGGGGACAGG - Intergenic
1122855064 14:104556181-104556203 GACTGGGGTGGGGTGGGGATGGG - Intronic
1122906629 14:104804726-104804748 TCCTGAGGACGGGTGGGAACAGG + Intergenic
1123021433 14:105399525-105399547 GCCTCAGGCGGGCTGGGGACAGG - Intronic
1123227005 15:17049475-17049497 GACTGTGGTGGGGTGGGGGCAGG - Intergenic
1124208508 15:27743335-27743357 TCTTGAGAAGGGGTGGGGACAGG + Intergenic
1124291087 15:28455108-28455130 GACTGGGGCGGGGCGGGGCCCGG - Intergenic
1125201389 15:37102878-37102900 GAGTGCGGCGGGGTGGGGAGGGG + Intergenic
1127899812 15:63332795-63332817 CACTGAGGAGGGGAGGGAACTGG + Intronic
1128241920 15:66107187-66107209 CAAGTAGGCGGGGTGGGGACTGG - Intronic
1130218945 15:82001026-82001048 GACTGTGGTGGGGTGGGGGCAGG + Intergenic
1130648150 15:85746465-85746487 GAATGAGGCGGGGTGGGGGAGGG - Intronic
1130991146 15:88876894-88876916 TCCTGAGGCGGGGGTGGGAGTGG + Intergenic
1131150998 15:90047105-90047127 TTCTGGGGGTGGGTGGGGACAGG + Intronic
1131426147 15:92346922-92346944 TGCTGAGACTGGGTGGGCACAGG + Intergenic
1132043806 15:98547828-98547850 TCTGGAGGCGGGGTGGGGCCGGG + Intergenic
1132089403 15:98935692-98935714 CACTGATGTGGGGAGGGGACTGG - Intronic
1132318816 15:100910119-100910141 GACTGAGGTGGGAGGGGGACAGG - Intronic
1132687696 16:1169154-1169176 TCCTGCGGCGGGGTGGGGGTGGG + Intronic
1132805365 16:1772766-1772788 TGCAGGGGCGGGGTGCGGACGGG + Intronic
1133031343 16:3012739-3012761 TGCTGCGGCTGAGTGGGGACAGG - Exonic
1133232535 16:4373348-4373370 GACAGGGGCGGGGTGGGGACAGG - Intronic
1133288707 16:4703956-4703978 GCCTGAGGTGTGGTGGGGACAGG - Intronic
1134379582 16:13711536-13711558 TACTGAGACAGGGTGGTCACAGG - Intergenic
1135128204 16:19829234-19829256 CACTGAGGGAGGATGGGGACAGG - Intronic
1135357161 16:21778958-21778980 GACTGGGGTGGGGTGGGGAATGG + Intergenic
1135435627 16:22425085-22425107 TGCAGAGACGGGGAGGGGACCGG + Intronic
1135455665 16:22595074-22595096 GACTGGGGTGGGGTGGGGAATGG + Intergenic
1135671496 16:24379550-24379572 TACTGAGGCTGGGGGTGGATAGG - Intergenic
1137363104 16:47838492-47838514 TACTGTTGTGGGGTGGGGAGAGG + Intergenic
1138154870 16:54693709-54693731 AACTGAGTCAGGGTGGGGCCTGG + Intergenic
1139647902 16:68345383-68345405 TACTCTGATGGGGTGGGGACTGG + Intronic
1139808521 16:69591285-69591307 AACTGGGGCGGGGTGGGGAGGGG - Intronic
1140410611 16:74738478-74738500 GTCTGAGGCTGGCTGGGGACGGG - Intronic
1141323022 16:83029729-83029751 TACTCAGGAAGGGAGGGGACTGG + Intronic
1141700543 16:85640180-85640202 CAAGGAGGCGGGGTGGGAACGGG - Intronic
1142044834 16:87918893-87918915 TGCAGAGACGGGGAGGGGACCGG + Intronic
1142144279 16:88486342-88486364 TACTGAGGCTGGGAGGGGCATGG - Intronic
1142260035 16:89038460-89038482 TACTGAGTCGGGGAGGGGATGGG - Intergenic
1142808282 17:2383202-2383224 TCCTGAGGTGGGGTGGGTAGGGG - Intergenic
1142929998 17:3275934-3275956 GACTGTGGTGGGGTGGGGGCAGG + Intergenic
1143217077 17:5233207-5233229 GGCTGAAGCGGGGTGGGGATGGG - Intronic
1143455679 17:7066076-7066098 GAGTGAGGCTGGGTGGGGAGTGG - Intergenic
1143457640 17:7078192-7078214 TAGTGAGGAGGGCTGGGCACAGG + Intronic
1143913067 17:10267834-10267856 TAATGAGACTGGGTGGCGACGGG + Intergenic
1144048013 17:11470705-11470727 TTCTGAGGAGGGGTGGGGGTGGG + Intronic
1145191459 17:20843972-20843994 GACGGAGGCGGGGCGGGGCCCGG + Intronic
1146336799 17:31979429-31979451 TATGGAATCGGGGTGGGGACAGG - Intronic
1146948699 17:36891174-36891196 CACTGGGGCAGGGTGGGGCCAGG - Intergenic
1147179146 17:38673966-38673988 TCCTGAGGCGGGCTGGCGGCTGG + Exonic
1147325511 17:39667796-39667818 TTCTGGGGCGGGGTGGGGAGGGG + Intergenic
1148080743 17:44966769-44966791 TCCTGAGGCGGGGAGGGGGTGGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1150416737 17:64994557-64994579 TCCTGGGGGGGTGTGGGGACAGG + Intergenic
1150600317 17:66645573-66645595 TATTAAGGCAGGGTGGGGGCTGG + Intronic
1151197999 17:72445603-72445625 TACGCAGGCTGGGTGGGGTCAGG - Intergenic
1151537555 17:74747624-74747646 TAGGGAGGTGGGGTGGGGAGAGG - Intergenic
1151623155 17:75259624-75259646 GACTGAGGAGAGGTGAGGACGGG + Intronic
1152165957 17:78706289-78706311 TGCTGGGGCGGGGTGGGGTGGGG - Intronic
1152215918 17:79032381-79032403 GACTCACGCGGGGTGGGGAAGGG + Intronic
1152325254 17:79632286-79632308 TACAGATGAGGGGTGGGGCCGGG + Intergenic
1152759758 17:82101656-82101678 TAGTGGGGCGGGGTGGGGGGAGG + Exonic
1152806122 17:82357204-82357226 AACTGAGGCTGGGAGGGGCCAGG + Intergenic
1153480361 18:5542467-5542489 TGTTGAGGGGGGGTGGGGAGTGG - Intronic
1153843252 18:9026007-9026029 TACAGAGGGGGAGTGGGGAGTGG + Intergenic
1154196498 18:12271250-12271272 TACTGGGGCGGGGTTGGGGTGGG + Intronic
1154485330 18:14867742-14867764 TCCTGACCTGGGGTGGGGACTGG - Intergenic
1155229173 18:23756950-23756972 TACTGGGGCGGGGCGGGGCGGGG - Intronic
1157268060 18:46246237-46246259 GGGTGAGGCGGGGTGGGGAGGGG + Intronic
1157488531 18:48106822-48106844 TTCTGCAGCGGGGTGGGGAATGG + Intronic
1157674695 18:49560698-49560720 TAATGAGGCGAGGTCGGAACAGG + Intronic
1160793153 19:932330-932352 AACTGAGGCTGGGCGGGGAGTGG + Intronic
1160977917 19:1802807-1802829 CCCTGAGGCCAGGTGGGGACAGG - Intronic
1161197333 19:2994097-2994119 TACTGCGGTGGGCTGGGGGCAGG + Intronic
1161252045 19:3285674-3285696 TACCGAGACGGGGCGGGGAAGGG - Intronic
1162562676 19:11426570-11426592 TCCTGGGGCGTGGTGGGGAGGGG + Exonic
1162885199 19:13691781-13691803 CACTGAGGTGGGGTGAGGTCCGG + Intergenic
1163357180 19:16821399-16821421 TTCTGGGGCGGGGTGGGGGTCGG + Intergenic
1163421199 19:17214618-17214640 TACTGAGGTGGGCTGGGAAGGGG + Intergenic
1163694587 19:18757492-18757514 TTCTGAGGCAGGGTGGGGTCTGG - Intronic
1164506940 19:28868786-28868808 GAGTGAGGTGTGGTGGGGACAGG - Intergenic
1164639179 19:29812160-29812182 TACTGCCGCGGGCTGCGGACAGG + Intronic
1165471548 19:36007327-36007349 TACAGAAGAGGGGTGGGGATGGG - Intronic
1165726686 19:38117654-38117676 TCCTGCTGCGGGGTGGGGAAGGG + Intronic
1165831746 19:38733978-38734000 AGCTGAGGCTGGGTGGGGGCAGG + Intronic
1165920948 19:39297686-39297708 CTCTGGGGCGGGGTGGGGACGGG - Intronic
1166845708 19:45726966-45726988 TACTGAGGCTGGCTGGGCACTGG + Intronic
1167109080 19:47448230-47448252 CGCTGCGGCGGGGTGGGGAGGGG + Exonic
1167354387 19:48994115-48994137 ATCTGAGGCGGGGAGGGGGCTGG + Intronic
1167567685 19:50267157-50267179 TACTGAGGCCGGGCGGGGATTGG + Intronic
1168123214 19:54266585-54266607 GACTGAGGCTGGGTGAGGACAGG - Intronic
925640190 2:5979588-5979610 GACTGAGGCTGGATGGGGAGGGG - Intergenic
926144507 2:10388504-10388526 GACAGGGGTGGGGTGGGGACAGG - Intronic
926305301 2:11633763-11633785 TAGTGAGGAGGGGTGGGGCTGGG - Intronic
926711824 2:15888212-15888234 GCCTCAGGCAGGGTGGGGACAGG + Intergenic
927479571 2:23441321-23441343 GACTGTGGCGGGGTGGGGGGAGG + Intronic
927702272 2:25276044-25276066 TACTGGGGGGCGGTGGGTACCGG + Intronic
927856282 2:26529839-26529861 TTCAGAGGCGAGGTGGGCACAGG + Intronic
928092633 2:28385001-28385023 GGCTGGGGCGGGGTGGGGAAAGG - Intergenic
928465757 2:31520800-31520822 TTATGAGGTGGGTTGGGGACAGG - Intergenic
929461131 2:42102636-42102658 GAATGAGGCGGGGTGGGGTGGGG - Intergenic
929604875 2:43227259-43227281 TACTGAGCCTGGGCGGGGAGGGG - Intergenic
932337215 2:70938203-70938225 GAGTGAGGCGGGGAGGGGATTGG - Intronic
933054802 2:77648166-77648188 GACTGTGGCGGGGTGGGGGGAGG + Intergenic
933062909 2:77759607-77759629 GACTGTGGCGGGGTGGGGGGAGG + Intergenic
935412963 2:102785222-102785244 GACTGAGGAGGAGTGGGGAGTGG - Intronic
937161434 2:119766121-119766143 TCCTGGGGCAGGGTGGGGAGGGG - Intronic
937229406 2:120388880-120388902 AATTGAGGTGGGGTGGGGATGGG + Intergenic
937257702 2:120566588-120566610 AACTGAGGTGGGGTGGGGAGGGG - Intergenic
938763343 2:134444254-134444276 TACGGAGGTGGGGAGGGGCCAGG - Intronic
940739496 2:157490876-157490898 TATTGAAGCTGGGTGGGGGCAGG - Intergenic
941991261 2:171559942-171559964 GACTGAGGCGTGGTGGGAGCAGG - Intergenic
942769875 2:179504025-179504047 GACTGTGGTGGGGTGGGGAGAGG - Intronic
944261967 2:197687683-197687705 GACTGTGGTGGGGTGGGGAGAGG - Intergenic
947640316 2:231704040-231704062 TACTCAGGCTGGGCGGGGAGAGG + Intergenic
947879100 2:233489426-233489448 CTCTGAGGTGGGCTGGGGACGGG + Exonic
948560658 2:238849082-238849104 TCCTGGGGCCGGCTGGGGACTGG + Intronic
948921904 2:241069763-241069785 TGCCGAGGCGGGGTGTGGGCTGG - Intronic
948940083 2:241191073-241191095 TTCTGGGGCAGGGCGGGGACGGG + Intronic
948942439 2:241203172-241203194 TAATGTGGAGGGGTGGGTACAGG - Intronic
1170596195 20:17807310-17807332 ACCTGGGGCGGGGAGGGGACTGG + Intergenic
1172123029 20:32609638-32609660 CAGTGAGCCGGGGAGGGGACAGG - Intergenic
1172330723 20:34074546-34074568 CACAGGGGCGGGGTGGGGATGGG - Intronic
1173138042 20:40457612-40457634 CACTGTGGCGGGGTGGGGAGGGG + Intergenic
1174115585 20:48224468-48224490 TGCTGAGCCGTGGTGTGGACCGG - Intergenic
1174134965 20:48373250-48373272 GAATGAGGCGGGGGAGGGACTGG - Intergenic
1175443142 20:59004555-59004577 AATTGGGGCGGGGTGGGGCCGGG + Intronic
1176366993 21:6039294-6039316 GACTGATGCAGGGTGAGGACAGG - Intergenic
1176411663 21:6452448-6452470 TAATGAGCTGGGGTGGGCACTGG + Intergenic
1176414666 21:6467677-6467699 GGCTGCGGCGGGGTGGGGAAGGG - Intergenic
1176723966 21:10414650-10414672 TCCTGACCTGGGGTGGGGACTGG - Intergenic
1176796004 21:13371734-13371756 TCCTGACCTGGGGTGGGGACTGG + Intergenic
1177691106 21:24508528-24508550 TACTGAGGTAGGGAGGGGAATGG - Intergenic
1178636521 21:34308528-34308550 TAATGAGGGTGGGTGGGGGCAGG + Intergenic
1178761090 21:35403566-35403588 TAATGAGGCAGGGCTGGGACAGG - Intronic
1179687157 21:43060770-43060792 TAATGAGCTGGGGTGGGCACTGG + Intronic
1179690166 21:43075999-43076021 GGCTGCGGCGGGGTGGGGAAGGG - Intronic
1179756525 21:43499252-43499274 GACTGATGCAGGGTGAGGACAGG + Intergenic
1180110023 21:45643298-45643320 AAGTGAAGCGGGGAGGGGACGGG - Intergenic
1180305211 22:11067824-11067846 TCCTGACCTGGGGTGGGGACTGG - Intergenic
1181313122 22:21956150-21956172 TACTGAGTTGGGGCGGGGGCGGG + Intergenic
1181346227 22:22222222-22222244 TACTGAGTTGGGGCGGGGGCGGG + Intergenic
1182105522 22:27686355-27686377 TGCTGAGGCTTGGTGGGCACTGG - Intergenic
1182412944 22:30202609-30202631 TACTCAGGCTGGGTGGGGTAAGG - Intergenic
1182572483 22:31249399-31249421 GACTGAGGAGGTGTGGGGGCTGG - Intronic
1183312526 22:37118405-37118427 TGCTGAGGCAGGGCTGGGACTGG + Intergenic
1183587649 22:38762392-38762414 AGCTGAGGAGGGGTGGGGGCTGG - Intronic
1183743251 22:39679692-39679714 GACGGGGACGGGGTGGGGACAGG - Intronic
1184313922 22:43667502-43667524 TACAGTGGCAGGCTGGGGACAGG + Intronic
1184571228 22:45326170-45326192 CAGAGAGGCGGGGTGGGGGCGGG - Intronic
1184745387 22:46452873-46452895 TACTGAGGCCTGGAGGGCACAGG - Intronic
1184782436 22:46655968-46655990 AACGGAGGCGGGGCGGGGAGGGG + Intronic
1185256893 22:49838905-49838927 TACTGGGGAGGCGTGGGGAGAGG - Intergenic
949820508 3:8111089-8111111 TAATGAGGTGGGAAGGGGACTGG - Intergenic
949949560 3:9217877-9217899 CACAGAGGCAGGGAGGGGACAGG + Intronic
950450122 3:13060666-13060688 TGCTGGGGCAGGGTGGGGGCCGG + Intronic
951906672 3:27713812-27713834 TGCCGGGGCGGGGTGGGGACCGG + Intergenic
952792762 3:37213427-37213449 TTTTGGGGGGGGGTGGGGACAGG + Intergenic
954751054 3:52813922-52813944 AGCTGGGGTGGGGTGGGGACTGG - Intronic
955947551 3:64209855-64209877 AACTGAGGATGGGTGAGGACGGG + Intronic
957642110 3:82867454-82867476 GACTGTGGTGGGGTGGGGGCAGG + Intergenic
957681763 3:83445460-83445482 GACTGTGGCGGGGTGGGGGTAGG - Intergenic
958903850 3:99920656-99920678 CACTGAGGGTGGGTGGGGGCAGG - Intronic
961551358 3:127672247-127672269 GACTGAGGCGGGGTGGGGAGAGG - Exonic
961603744 3:128078596-128078618 AAGTGAGGCAGGGTGGGGGCTGG - Intronic
961903493 3:130238315-130238337 GACTGTTGTGGGGTGGGGACAGG - Intergenic
962237845 3:133723804-133723826 GACTGTGGTGGGGTGGGGAAGGG - Intergenic
962375948 3:134858835-134858857 TACTGAGGCAGGCTGGGCTCTGG - Intronic
962389457 3:134959132-134959154 TACTGAGGTGGGGTGGGTAGTGG + Intronic
962467094 3:135670666-135670688 TACTGAGCTGATGTGGGGACTGG - Intergenic
962750776 3:138433627-138433649 GACCGGGGCGGGGTGGGGAGGGG + Intergenic
962841919 3:139241322-139241344 TACTACTGCGGGGTGGGGAGGGG - Intronic
962964207 3:140338560-140338582 TACTGAGGCCGGGGGGGGACTGG - Intronic
964204095 3:154151795-154151817 TACTGTGGCTGGGTGGGAGCAGG - Intronic
964623367 3:158736416-158736438 CACTGAGGCGAGGAGGGGAAGGG + Intronic
965033489 3:163404567-163404589 GACTGTGGTGGGGTGGGGAGAGG - Intergenic
965693298 3:171380662-171380684 TTGTGAAGAGGGGTGGGGACAGG - Intronic
966914971 3:184579631-184579653 AGCTGAGGCGGGCTGGGTACAGG + Intronic
966924704 3:184636753-184636775 TAAGGAAGCGGGGTGGGGAGGGG - Intronic
967225616 3:187288389-187288411 TGCTGAGGAGGGGAGGGCACTGG + Intronic
968150849 3:196335589-196335611 TCCTGGGGCAGGGTGGGGTCAGG + Intronic
968230193 3:197001315-197001337 TACTGAGGTGGGGGTGGGCCCGG - Intronic
968586298 4:1417888-1417910 ACCTGGGGTGGGGTGGGGACAGG - Intergenic
968665043 4:1816391-1816413 TACTGAGCGTGGGTGGGGTCAGG + Intronic
968810844 4:2799100-2799122 TCCTGAGGCAGGGCGGGTACGGG - Intronic
968997643 4:3955664-3955686 TCCTGGGGCGGGGTCGGGACAGG + Intergenic
969059828 4:4425781-4425803 TGCTCAGGCTGGGTGAGGACGGG + Intronic
969329196 4:6463351-6463373 TCCTGAGGAGGGGTGGGGGTGGG + Intronic
969534365 4:7746897-7746919 CACAGAGGCGCGGTGGTGACGGG - Intergenic
969641623 4:8402189-8402211 CCCTGGGGCCGGGTGGGGACGGG + Intronic
971153070 4:24054248-24054270 TACTGAGGAGAGGTGGTGTCTGG + Intergenic
971700864 4:29973546-29973568 GACTGTGGTGGGGTGGGGAGAGG - Intergenic
972733201 4:41815220-41815242 TGCTCAGGGGGAGTGGGGACGGG - Intergenic
972779209 4:42271350-42271372 TCCTGAGGGGAGGTGGTGACAGG - Intergenic
974063024 4:57052589-57052611 ACCTGGGGTGGGGTGGGGACGGG - Intronic
974265295 4:59579685-59579707 GACTGTGGTGGGGTGGGGAGAGG - Intergenic
974690120 4:65288382-65288404 GACTGTGGCGGGGTGGGGGGAGG - Intergenic
976136676 4:81945105-81945127 TACTGTGGGGAGGTGGGGATGGG + Intronic
976226333 4:82798067-82798089 GACCGCGGCGGGGTGGGGGCGGG + Intronic
977087112 4:92615205-92615227 TACCGAGGTGGGGTGGGGCAGGG + Intronic
984081955 4:175258015-175258037 GACTGTGGTGGGGTGGGGAGGGG + Intergenic
985289269 4:188371096-188371118 TCAGGAGGCGGGTTGGGGACTGG - Intergenic
985491611 5:182961-182983 TACTCATGTGGGCTGGGGACAGG + Exonic
985491626 5:183035-183057 TACTCATGTGGGCTGGGGACAGG + Exonic
985655687 5:1130447-1130469 TCCTGGGGTGGGGTGGGGGCGGG - Intergenic
985762293 5:1755747-1755769 TCCTGAGGCTGGCTGAGGACAGG + Intergenic
986473023 5:8094567-8094589 AACTCAGGCTGGCTGGGGACAGG - Intergenic
988254535 5:28804644-28804666 GACTGTGGTGGGGTGGGGGCAGG + Intergenic
988257679 5:28843151-28843173 GACTGTGGTGGGGTGGGGGCAGG - Intergenic
989198288 5:38737488-38737510 TACTGGGGTGTGGTGGGGGCGGG + Intergenic
989429254 5:41333173-41333195 TTCTTAGGCTGGGTTGGGACGGG - Intronic
989475968 5:41872894-41872916 TACTGGGGTGGGGTGGGCAGTGG + Intergenic
990509917 5:56480969-56480991 GACAGGGGCGGGGTGGGGAGGGG + Intronic
991011248 5:61885098-61885120 TTGTGGGGCTGGGTGGGGACAGG - Intergenic
992234271 5:74693091-74693113 TACTGAGGGAAGGTGGGTACAGG + Intronic
992256173 5:74923313-74923335 TCCAGGGGCGGGCTGGGGACAGG - Intergenic
994100105 5:95882577-95882599 TACCGAGGTGGGGTGGGGGTGGG + Intergenic
994177853 5:96731651-96731673 GACTGTGGAGGGGTGGGGAGAGG - Intronic
994185636 5:96811912-96811934 TACTGAGGAAGGTTGGAGACAGG - Intergenic
994258050 5:97623763-97623785 CACTCAGGTGGGGTGGGGATGGG + Intergenic
994447677 5:99898650-99898672 TACTGTGGTGGGGTGGGGGGAGG + Intergenic
996405445 5:123098841-123098863 CACTGAAGCAGGGCGGGGACAGG - Intronic
996831659 5:127747255-127747277 GACTGTTGCGGGGTGGGGAGAGG - Intergenic
996984771 5:129546228-129546250 GACTGTGGTGGGGTGGGGGCAGG + Intronic
997452452 5:133994825-133994847 AACTCAGCCGGGGTGGGGGCTGG + Intronic
997727439 5:136133185-136133207 TCCTGAGGCGGGGCCGGGGCTGG + Intronic
999138988 5:149344981-149345003 TACTGAGGCGGGAGGGCAACAGG - Intergenic
999394807 5:151220783-151220805 AGCGGAGGGGGGGTGGGGACTGG - Intronic
999482669 5:151963160-151963182 CAATGAGGCAGGGTGGGGAGTGG - Intergenic
1001154012 5:169257380-169257402 TTGTGGGGCGGGGTGGGGGCGGG - Intronic
1001517950 5:172369800-172369822 AGCTGGGGCGGGGTGGGGAGGGG - Intronic
1001558080 5:172649795-172649817 TTCTGAGGCTGGGTGGACACAGG - Intronic
1001980545 5:176034866-176034888 TCCTGACCTGGGGTGGGGACTGG + Intergenic
1002236916 5:177809199-177809221 TCCTGACCTGGGGTGGGGACTGG - Intergenic
1002724108 5:181283181-181283203 TCCTGACCTGGGGTGGGGACTGG - Intergenic
1002852451 6:1008422-1008444 TACTGAGGAGGAGAGGGAACTGG + Intergenic
1005260862 6:24057853-24057875 GACAGAGGCTGAGTGGGGACAGG - Intergenic
1006124798 6:31830517-31830539 CACTGGGGCGGGGAGGGGAGGGG + Intergenic
1006180102 6:32149400-32149422 TACGGAGGAGGGGTGGGGGAAGG + Intronic
1006472224 6:34235642-34235664 CGCGGAGGCGGGGTGGGGAGCGG - Intergenic
1007072928 6:39049535-39049557 TACAGAGGCTGGTAGGGGACGGG - Intronic
1007588634 6:43008106-43008128 TACTGAGGTGGGGTGGGAGCAGG + Intronic
1007596438 6:43053796-43053818 CACTGGGGCAGGGTGGGGCCCGG + Exonic
1007627610 6:43255180-43255202 TGCTGGGGAGGGGTGGGGAGAGG + Intronic
1008800539 6:55363586-55363608 GACTGAGGTGGGGTGGGGGGAGG - Intronic
1010445898 6:75948464-75948486 AATTGTGGTGGGGTGGGGACAGG - Intronic
1010450354 6:75995501-75995523 AACTGAGGAGGGGTGGTGAAGGG - Intronic
1010531718 6:76976726-76976748 GACTGTGGTGGGGTGGGGAGAGG - Intergenic
1011354306 6:86458291-86458313 CTCTGAGGAGGGGTGGTGACAGG - Intergenic
1011999075 6:93631738-93631760 GACTGTGGTGGGGTGGGGAGAGG - Intergenic
1012444193 6:99291647-99291669 TACTGGGGCTGGGTGGGCAGTGG - Intronic
1013241903 6:108254154-108254176 TACTGGGGTGGGGTGGGGTTTGG - Intronic
1016395970 6:143624009-143624031 CACTGGGGCAGGGTGGGGAGTGG - Intronic
1016444127 6:144115785-144115807 TAGTGAGGAGGAGTGGGGATGGG - Intergenic
1017418179 6:154244013-154244035 TACTGAGGAAGTGTAGGGACGGG + Intronic
1019515703 7:1438966-1438988 TCCTGCGGCGGGGTGGGGAGGGG + Exonic
1019923045 7:4174883-4174905 AACAGAGGAGGGGTGGGAACGGG - Intronic
1020120778 7:5502038-5502060 GACAGAGGCAGGGTGGGGAGAGG + Intronic
1020746699 7:12088653-12088675 TACAGGGGCAGGGTGGGGAGAGG + Intergenic
1021248839 7:18298433-18298455 GACTGTGGTGGGGTGGGGAGCGG - Intronic
1021560655 7:21965832-21965854 AACTGAGGGGAGGTGGGGGCTGG - Intergenic
1022069489 7:26898478-26898500 GACTGTGGTGGGGTGGGGGCAGG - Intronic
1022438755 7:30414625-30414647 GACTGTGGTGGGGTGGGGGCAGG - Intergenic
1023810409 7:43906753-43906775 AGCTGGGGCGGGGTGGGGGCGGG + Exonic
1025573722 7:62607653-62607675 GACTGTGGCGGGGTGGGGGGAGG - Intergenic
1027346492 7:77265147-77265169 GACTGAGGAGGGGTGGCCACAGG - Intronic
1028277279 7:88872618-88872640 TACTGTTGTGGGGTGGGGGCAGG - Intronic
1029170285 7:98625340-98625362 CACAGGGGCGGGGTGGGGAGGGG + Intronic
1029202437 7:98848027-98848049 CACTGAGATGGGGTGGGGAGGGG + Exonic
1029217427 7:98961335-98961357 TACTGAGGATGGCTGGGGACTGG - Exonic
1029227923 7:99041567-99041589 CACTGAGGCGAAGTCGGGACAGG - Intronic
1029715338 7:102322408-102322430 GAATGAGACGGGGTGGGGGCTGG - Intergenic
1033278792 7:139991419-139991441 TTCTGGGGTGGGGTGGAGACGGG - Intronic
1033578070 7:142705014-142705036 GCCTGAGGCAGGGTGGGGAAGGG - Intergenic
1033586862 7:142780600-142780622 TTCTGAGCAGGGGAGGGGACAGG - Intergenic
1034386435 7:150744723-150744745 GACTGGGGCTGGGTGGGGAGGGG - Intronic
1034414084 7:150955847-150955869 TAGTGTGGCGGGGTGGGGGTGGG - Intronic
1035412405 7:158655697-158655719 TCATGAGGCAGGGAGGGGACGGG - Intronic
1035699109 8:1624665-1624687 CACAGAGGAGGGGAGGGGACAGG + Intronic
1035736043 8:1888278-1888300 TTCTGAGGAGGGGTGGGGTGAGG + Intronic
1039398316 8:37246631-37246653 TCCTGAGGCTGGGAGGAGACTGG - Intergenic
1042338268 8:67651891-67651913 GACTGTTGCGGGGTGGGGGCAGG - Intronic
1045882515 8:107058097-107058119 TACTGTGGTGGGGTGGGGGGAGG - Intergenic
1046295713 8:112217311-112217333 AAGTGAGGGGGGGTGGGGAATGG - Intergenic
1048249969 8:132856733-132856755 GGCTGTGGCGGGGTGGGGAATGG + Intergenic
1048540935 8:135341782-135341804 GACTGAGGAGGGGAGGGGCCAGG + Intergenic
1050187336 9:2988211-2988233 AACTGGGGCAGGTTGGGGACAGG - Intergenic
1051729961 9:20130912-20130934 TACTGAGGCTGGGTCTGGGCAGG - Intergenic
1052891551 9:33704826-33704848 GCCTGAGGCAGGGTGGGGAAGGG - Intergenic
1053299216 9:36936733-36936755 TAGGGTGGCAGGGTGGGGACAGG + Intronic
1053329176 9:37188518-37188540 TAATAAGGAGGGGTGGGGAGAGG - Intronic
1053886247 9:42646615-42646637 TCCTGACCTGGGGTGGGGACTGG - Intergenic
1054225267 9:62454064-62454086 TCCTGACCTGGGGTGGGGACTGG - Intergenic
1057201387 9:93142183-93142205 TCCTGTGGCAGGGAGGGGACAGG + Intergenic
1058678793 9:107423789-107423811 AAGTGGGGCTGGGTGGGGACGGG + Intergenic
1059219137 9:112595549-112595571 TACTGGGGTGGGGTGGGGGTAGG + Intronic
1059419233 9:114180816-114180838 TACTGGAGAGGGTTGGGGACGGG + Intronic
1059569572 9:115420139-115420161 TACTGTTGTGGGGTGGGGAGAGG + Intergenic
1060601490 9:124881297-124881319 AGGTGAGGCGGGGTGGGGTCGGG + Intronic
1061001173 9:127903846-127903868 TAGTGAGAAGGGCTGGGGACAGG - Intronic
1061537437 9:131258743-131258765 GTCTGAGGATGGGTGGGGACAGG - Exonic
1061943977 9:133898179-133898201 AACTGAGGCCGGGCGGGCACAGG + Intronic
1062169832 9:135128953-135128975 CACTGAGGTGGGGTGAGGGCTGG + Intergenic
1062218205 9:135400361-135400383 AACTGAGGCAGGCTGGGGATGGG - Intergenic
1062607522 9:137354831-137354853 TTCTGGGGCGGGCTGGAGACGGG + Intronic
1203746172 Un_GL000218v1:41674-41696 TTCTGGGGCGGGGTGGGGCAGGG + Intergenic
1189567107 X:42254407-42254429 GAGTGAGGTGGGGTGGGGAAGGG + Intergenic
1191221218 X:57989985-57990007 GACTGAGGGGGGCTGGGCACTGG + Intergenic
1191274047 X:58516619-58516641 GACTGTGGCGGGGTGGGGGGAGG + Intergenic
1192101776 X:68271962-68271984 AGCTGAGGCGGGGTTGGGGCAGG - Intronic
1193749626 X:85326411-85326433 TACTGCTGGGGGGTGGGGGCGGG + Intronic
1196655877 X:118216636-118216658 TACAGAGGCGGGGTGGTAGCAGG - Intergenic
1196735105 X:118975720-118975742 GACTGTGGCGGGGTGGGGGAGGG + Intronic
1197770624 X:130086962-130086984 TGCTGGGGCGGGGTGAGGACAGG - Intronic
1197963556 X:132032046-132032068 TAGTGAGGGGTGGTGGGGAGAGG - Intergenic
1200120533 X:153788168-153788190 TGCTGAGGTGGGGCGGGGATGGG - Intronic