ID: 914243805

View in Genome Browser
Species Human (GRCh38)
Location 1:145871522-145871544
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914243805_914243808 -7 Left 914243805 1:145871522-145871544 CCACCCTGAAGTGGAGGCGAGAA No data
Right 914243808 1:145871538-145871560 GCGAGAAGAGCAGCTCTCGCTGG 0: 1
1: 0
2: 1
3: 4
4: 82
914243805_914243809 -6 Left 914243805 1:145871522-145871544 CCACCCTGAAGTGGAGGCGAGAA No data
Right 914243809 1:145871539-145871561 CGAGAAGAGCAGCTCTCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914243805 Original CRISPR TTCTCGCCTCCACTTCAGGG TGG (reversed) Intronic
No off target data available for this crispr