ID: 914244197

View in Genome Browser
Species Human (GRCh38)
Location 1:145873512-145873534
Sequence TCCAGTATGAAGTCCATGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914244197_914244205 23 Left 914244197 1:145873512-145873534 CCTTCCATGGACTTCATACTGGA 0: 1
1: 0
2: 0
3: 5
4: 117
Right 914244205 1:145873558-145873580 GCCTTCTTTGGAGCTAATACTGG 0: 1
1: 0
2: 0
3: 3
4: 83
914244197_914244203 11 Left 914244197 1:145873512-145873534 CCTTCCATGGACTTCATACTGGA 0: 1
1: 0
2: 0
3: 5
4: 117
Right 914244203 1:145873546-145873568 GCTGAGTCCTCAGCCTTCTTTGG 0: 1
1: 0
2: 1
3: 30
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914244197 Original CRISPR TCCAGTATGAAGTCCATGGA AGG (reversed) Exonic
900137579 1:1124935-1124957 ACCAGGACGAAGGCCATGGAAGG + Intergenic
902417720 1:16251274-16251296 TCCAGTAGTAATCCCATGGATGG - Exonic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905870141 1:41398887-41398909 TCCAGTGTGAGGCCCATGTAGGG + Intergenic
906005288 1:42463736-42463758 GCCACTACGAAGTCCACGGAGGG + Intronic
907528760 1:55071600-55071622 TGCAGTGTGAAGTGAATGGAAGG - Intronic
910221036 1:84889653-84889675 TCCAGTATGATGTCAGAGGACGG + Intronic
914244197 1:145873512-145873534 TCCAGTATGAAGTCCATGGAAGG - Exonic
915069947 1:153258546-153258568 GCCAGAAAGGAGTCCATGGAGGG - Intergenic
916728493 1:167545068-167545090 CCCACTAAGAAGTGCATGGAAGG - Intronic
920191180 1:204194901-204194923 TCCAGGATGAAGCCCCTGCAGGG - Intronic
920368796 1:205464018-205464040 TCCAGTAAGAAGTCTTTGGAAGG - Intergenic
1063687123 10:8247454-8247476 TCCAGTGTGCACTCCATGGGAGG + Intergenic
1064199874 10:13275225-13275247 TCAAGTCTGAAGCCCATTGAAGG - Intergenic
1065872157 10:29964746-29964768 AGCAGTAGGAAGTCCCTGGAGGG + Intergenic
1069678697 10:70267960-70267982 TACAGTTGGAAGTCCTTGGAAGG - Intronic
1071881442 10:89903070-89903092 AGGACTATGAAGTCCATGGAGGG - Intergenic
1076274654 10:129186902-129186924 TGCAGTGTGAAGACCATGTAGGG + Intergenic
1076442508 10:130489865-130489887 TCCAGCATGAAGTCCTAGGAAGG + Intergenic
1077509449 11:2948937-2948959 TCCAGTAAGAGGGCCCTGGATGG - Intronic
1078670136 11:13357260-13357282 GCCAGTATGGAGAGCATGGAGGG - Intronic
1079495872 11:21043471-21043493 TCCACCATGATGTCCATGTAAGG + Intronic
1080283029 11:30580646-30580668 TCCACTTTGAAGTGCATGAAGGG - Intronic
1083242820 11:61402316-61402338 TCCAGTATCAAGTTCAGGAAGGG - Intergenic
1090540898 11:127702904-127702926 TCCTGTATGTAATTCATGGATGG + Intergenic
1092548517 12:9472454-9472476 GCCAGTATGATGATCATGGAGGG - Intergenic
1094504487 12:31049995-31050017 GCCAGTATGATGATCATGGAGGG + Intergenic
1097318644 12:58201257-58201279 TCTAGAATGGAGTCAATGGAGGG + Intergenic
1098059003 12:66540060-66540082 TCCAGTCTGCAGTACATGCATGG + Intronic
1099379663 12:81938712-81938734 ACCAGTAGGAAGTCCATGTGGGG + Intergenic
1100575985 12:95891980-95892002 TCCAGGATGCAGTGCAGGGATGG - Intronic
1102844331 12:116162513-116162535 TTCAACATGAAATCCATGGATGG - Intronic
1105607607 13:21939734-21939756 TACATAATGAAGCCCATGGAAGG + Intergenic
1105673300 13:22643765-22643787 TCCTGTTTGACGTCCTTGGATGG - Intergenic
1108140673 13:47417411-47417433 TCTTGTATGAAGACCATGGCTGG + Intergenic
1113271108 13:108675439-108675461 TCCTGTATGAAGTGAATGTATGG + Intronic
1113448710 13:110390307-110390329 TCCAGGAAGACTTCCATGGAAGG + Intronic
1117344016 14:54815341-54815363 TCCAGTGAGAGGTCCAGGGATGG - Intergenic
1118960001 14:70520678-70520700 TCCATTCTGCAGCCCATGGATGG + Intergenic
1127754025 15:62073163-62073185 TCCAATCTGCAGTCCGTGGACGG + Intergenic
1127899123 15:63328296-63328318 TGCAGTATGAATTCCCTAGATGG - Intronic
1128269418 15:66294875-66294897 TCCAGTCTTAACTCCATGGTGGG - Intronic
1130399109 15:83532694-83532716 TCTAGCATGAAGTCCAGAGATGG + Intronic
1131382197 15:91973263-91973285 TCCAGTGTGAAGTGCCTGGGAGG - Intronic
1137863507 16:51870278-51870300 TCAAGTATGAAATCCATCCATGG + Intergenic
1139272533 16:65697662-65697684 TCCAGCATTCACTCCATGGAAGG - Intergenic
1140717088 16:77736214-77736236 TCCAGTTTGAAATCCACTGATGG - Intronic
1141429993 16:83966445-83966467 TCCTGGATGAGGTCCATGGCTGG + Intergenic
1145184842 17:20785084-20785106 TCCAGAATGATGTCTATGAATGG + Intergenic
1146839702 17:36142396-36142418 TCCAGTGCCAAGTCCAAGGATGG + Intergenic
1147628182 17:41913495-41913517 TCCAGTTTCAAGCCCATGGCAGG + Intronic
1148773228 17:50078910-50078932 TCAAGTATGAATTCCAGGTAAGG + Exonic
1154030940 18:10753881-10753903 TCCATTATGAAGTCAAGGAAGGG - Intronic
1155922802 18:31620035-31620057 TACAATATGTAGTTCATGGACGG - Intergenic
1158047438 18:53173283-53173305 TGCAGTATGAAGTTTCTGGAAGG - Intronic
1160059574 18:75516825-75516847 TTCAGAATGAAGGCCATGCATGG - Intergenic
1163733285 19:18962535-18962557 TGCAGTTTCAAATCCATGGAGGG + Intergenic
929009110 2:37423618-37423640 TCCAGTTTTAAGACCAGGGAGGG + Intergenic
929457056 2:42073451-42073473 CCCAGAATGGAGTCTATGGAGGG - Intergenic
931809684 2:65842669-65842691 TCAAGTCTGAAGTCTAGGGATGG + Intergenic
931845188 2:66196371-66196393 TGAAGAATGAAGTCCCTGGAGGG + Intergenic
933450637 2:82445746-82445768 TCCAGTATGAAATGCAGGGAGGG + Intergenic
936683153 2:114798172-114798194 TCCAGGATGGAGTCCCAGGATGG + Intronic
936935869 2:117837600-117837622 TTCAGTATGAAGTAGATGTAAGG - Intergenic
937244180 2:120481986-120482008 TACAGTAGGAAGGCCATGGGGGG - Intergenic
937533778 2:122860776-122860798 TGAAGTATGCAGTCCATGCAGGG - Intergenic
937890409 2:126934198-126934220 TCCAGACTGCAGACCATGGAAGG + Intergenic
941162891 2:162055238-162055260 TCCAATATGGAGGCTATGGATGG - Intronic
946183464 2:217963132-217963154 TCAAGAATTAAGTCCTTGGAAGG + Intronic
946196464 2:218035296-218035318 TCCTGTGTGAAATCCATGAACGG - Intronic
946200746 2:218069460-218069482 TCCTGTGTGAAATCCATGAACGG - Exonic
1169819873 20:9698588-9698610 TCCAGTGTGAAGTGAATGGGAGG - Intronic
1172296275 20:33813250-33813272 TCCAGAATGTAGTGCTTGGAGGG + Intronic
1174458455 20:50666065-50666087 CCCAGAATGAAGACCAAGGAAGG + Intronic
1177250452 21:18584640-18584662 TTCAGTTTGATGTCCATGCAAGG - Intergenic
1177384387 21:20389816-20389838 CCCAGAATGAAATACATGGAAGG + Intergenic
1177555573 21:22683498-22683520 TCCACTTTGTAGTTCATGGAGGG - Intergenic
1181326114 22:22047697-22047719 TCCAGCATGAGAGCCATGGATGG - Intergenic
1181868727 22:25880826-25880848 TCAAGGAAGAATTCCATGGAAGG + Intronic
1182228685 22:28819997-28820019 TCCAGTATGAGCTTCATGGCTGG + Intergenic
1184224245 22:43120094-43120116 TCAAGTATGCTTTCCATGGATGG - Intronic
949409080 3:3744267-3744289 TGCAGTATGAAGTTGCTGGAAGG - Intronic
954163353 3:48737764-48737786 CCAAGTATTAAGTCCAAGGAGGG + Intronic
954976363 3:54698950-54698972 TCCACTCTGAAGTCCTTGCAGGG - Intronic
955495277 3:59524877-59524899 TCCATTATGAAGTCAAATGAGGG - Intergenic
956238921 3:67107148-67107170 TCCAGTATTCTGTTCATGGAAGG - Intergenic
957287426 3:78234768-78234790 TCCAGTAGAATGTCCCTGGAAGG + Intergenic
958748005 3:98161170-98161192 TCAAGAAGGAAGTCCATGGATGG + Intergenic
958777077 3:98498356-98498378 TTCAGAATGAAATCCAAGGAGGG + Exonic
961847207 3:129775809-129775831 TACAGTATGGAGCACATGGAGGG - Intronic
963778870 3:149466655-149466677 TCCAGTGGGAAGTCTAAGGAAGG + Intergenic
964231708 3:154477768-154477790 TTTATTATGAAATCCATGGAGGG + Intergenic
977873722 4:102124485-102124507 AACAGTATACAGTCCATGGATGG - Intergenic
979376887 4:119956978-119957000 TCCAGTCCGAAGTCCAAAGAAGG - Intergenic
982572993 4:157074332-157074354 TCCAATATAACATCCATGGATGG + Intergenic
985042223 4:185903038-185903060 GTGAGTATTAAGTCCATGGAAGG + Intronic
988009614 5:25465157-25465179 TCCAGTAAGAAGTCTGTTGAAGG + Intergenic
988357665 5:30199196-30199218 TCCAGAATGAGGACCAAGGAAGG - Intergenic
996417228 5:123223244-123223266 TGTAGCATGAAGTCCAGGGAAGG - Intergenic
1000908152 5:166988729-166988751 TCCAGTGTGAGGGACATGGAGGG - Intergenic
1001661907 5:173399754-173399776 TCCATTAGGCACTCCATGGAAGG - Intergenic
1004053365 6:12110327-12110349 TCTAGTATGAAAGCCCTGGATGG + Intronic
1009562941 6:65272389-65272411 TTCAGCCTGCAGTCCATGGATGG + Intronic
1010829463 6:80512192-80512214 GCCAGATTGAAGTCCATGGCAGG + Intergenic
1012299632 6:97569803-97569825 TCCAGGATGCAGCCCAAGGAAGG + Intergenic
1018088852 6:160328661-160328683 TCCATTATGAACTCCATGACTGG - Intergenic
1029792544 7:102860039-102860061 TCCAGTATCACGTTCATTGAGGG + Intronic
1033382997 7:140842080-140842102 TCCAGTATTAATTTCATTGAAGG + Intronic
1034007820 7:147493533-147493555 TCCAGTATCTATTCCATGTATGG - Intronic
1035543015 8:456826-456848 TCCATTCTGAAGTCCCAGGAAGG + Intronic
1037812460 8:22095162-22095184 CCCAGTATGAACTCCAGGAAGGG - Intronic
1038551749 8:28475756-28475778 TCAAGTACAGAGTCCATGGAAGG + Intronic
1038586218 8:28791346-28791368 TACAGTATGAAGTTCAGGGTGGG - Intronic
1041571203 8:59338477-59338499 TCCAGCATGCAGCACATGGAAGG - Intergenic
1046193325 8:110828091-110828113 TACAGTATGAAGACCTTAGAAGG - Intergenic
1047719827 8:127629443-127629465 TACTTTATAAAGTCCATGGAGGG - Intergenic
1048674019 8:136756645-136756667 TCCAGTATGAATTCTAGAGAGGG - Intergenic
1050526992 9:6554833-6554855 TCCAGTGTGAAGGCCATGGCTGG + Intronic
1186899778 X:14041798-14041820 CCCAGGATGAAGTCTATGAATGG - Intergenic
1188278781 X:28237174-28237196 TCCATTCTGCAGCCCATGGATGG - Intergenic
1189525440 X:41814979-41815001 TCCAGTATGCAGCACAGGGAGGG + Intronic
1190616537 X:52239647-52239669 GAGAGTATGAAGTCCCTGGAGGG - Intergenic
1192588434 X:72339578-72339600 TACAGGATGAAGTTCAGGGAGGG + Intronic