ID: 914247870

View in Genome Browser
Species Human (GRCh38)
Location 1:145899269-145899291
Sequence GTCCCTCTGAACCACACTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914247867_914247870 -9 Left 914247867 1:145899255-145899277 CCTCGCCGCCTACAGTCCCTCTG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 914247870 1:145899269-145899291 GTCCCTCTGAACCACACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 110
914247866_914247870 -1 Left 914247866 1:145899247-145899269 CCTCTTGGCCTCGCCGCCTACAG 0: 1
1: 0
2: 0
3: 2
4: 104
Right 914247870 1:145899269-145899291 GTCCCTCTGAACCACACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914247870 Original CRISPR GTCCCTCTGAACCACACTGA TGG Exonic
901191235 1:7411184-7411206 GCCCCTCCAAACCACAGTGATGG - Intronic
902519970 1:17010765-17010787 GCCCCTCTGATCCACAGTGCTGG - Intronic
902946556 1:19844772-19844794 TTTGCTCTGAACCACACTGATGG + Intergenic
903660375 1:24973418-24973440 GTCCCTCTGAACGTCCCTGGTGG - Intergenic
904811422 1:33165561-33165583 CTCCCTCTGAAACACACACAGGG + Exonic
906056881 1:42924606-42924628 GGCACTCTGGACCACGCTGAGGG + Intergenic
906294257 1:44639558-44639580 GCCCCTCTGAACCAAACAGGAGG + Intronic
907264182 1:53245935-53245957 TTTCCTCTGAAGCACCCTGAAGG - Exonic
910403675 1:86862422-86862444 GTCACTTTGAACCACACAGAAGG + Intergenic
913193662 1:116434306-116434328 GTCCTGCTTAACCACACTGTGGG + Intergenic
914247870 1:145899269-145899291 GTCCCTCTGAACCACACTGATGG + Exonic
915213055 1:154324364-154324386 GTGGCTCTGCACCACCCTGAGGG + Exonic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
920019471 1:202943795-202943817 GTCCCACTGCGCCACAATGATGG + Exonic
923349599 1:233091038-233091060 GAACCTCTGCACCACAATGATGG - Intronic
1068890864 10:62147152-62147174 ATCCTTCTGGAGCACACTGAGGG - Intergenic
1070517958 10:77225592-77225614 CTCTCTCTGAACCACACGGCAGG + Intronic
1076673825 10:132137466-132137488 TCCTCTCTGACCCACACTGAAGG - Intronic
1077553789 11:3216163-3216185 GTCCCTCTGAGCCCCCCAGATGG + Intergenic
1078084551 11:8225835-8225857 GTCCCTCTGAACCTCACTTCAGG + Intronic
1084466415 11:69325645-69325667 CCCCCTCCGAACCACACCGAGGG - Intronic
1090106095 11:123854790-123854812 TTCCCTCTGAACCATAAAGATGG - Intergenic
1090578200 11:128131957-128131979 GTCTCTCTGGAGCCCACTGAGGG - Intergenic
1092386875 12:8042510-8042532 GTACCTCTTAACTACACCGATGG - Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1102208528 12:111107202-111107224 GTCCCTTTGAATCACACCTAAGG + Intronic
1102347301 12:112168296-112168318 GTCCCTCTGGGCCAGGCTGAGGG + Intronic
1103433740 12:120908418-120908440 GTCTCTCTGCACCCCACTGCAGG + Intergenic
1104800824 12:131554400-131554422 GTGCCTCTGTATCACCCTGAAGG + Intergenic
1105450495 13:20494962-20494984 GTCCCTCGGGACCACACAGCAGG - Intronic
1113575534 13:111392744-111392766 CTCCCTCTGAACCACCAGGAAGG - Intergenic
1117016955 14:51527878-51527900 GCCCCACTGAGCCTCACTGAAGG - Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1121971974 14:98366719-98366741 GTCCCTGTGCATCACAATGAGGG + Intergenic
1122133192 14:99618129-99618151 CTCCCTCTGACAGACACTGAGGG - Intergenic
1122159689 14:99774085-99774107 GGGCCTCTGAACCACACTTGGGG + Intronic
1122588205 14:102825856-102825878 GTCTCTCTGAAGCACGGTGATGG + Intronic
1123008887 14:105337781-105337803 GTGCCTCTGAACAAAACTGGGGG + Intronic
1125447602 15:39774817-39774839 GTCCCTCAGAACCACAAAGCTGG - Intronic
1129834896 15:78696181-78696203 GTCCCTCTGGCCAACACTGAAGG - Intronic
1133644293 16:7748766-7748788 GTCTGTCTAAACCACAGTGAAGG - Intergenic
1136186511 16:28591651-28591673 GTATCTCTGAGCCACATTGAGGG - Exonic
1138953773 16:61946162-61946184 GGACCTCTGAAACACACTCATGG + Intronic
1140847171 16:78901912-78901934 GTCCCTCCGCACCTCACTGTTGG + Intronic
1143287725 17:5802748-5802770 GTCCCTCTGATCAGCAGTGATGG + Intronic
1143514284 17:7411597-7411619 TTCCCTCTGGACCACTCTGCAGG - Intronic
1144129258 17:12229905-12229927 GTCCCTCTGAACCACACCGGGGG - Intergenic
1145101339 17:20080438-20080460 GTCCCTCTGAGACAGACTGCGGG + Intronic
1152715886 17:81900480-81900502 GTCCCTCAGAGCCAGCCTGAGGG - Intronic
1159900474 18:74040187-74040209 GGCCCTGTGAATCACAGTGAGGG - Intergenic
1162309965 19:9900435-9900457 ATCTCTCTGCACCACACTGGTGG + Intronic
1164745457 19:30609645-30609667 GTACATTTGAACAACACTGATGG - Intronic
925101570 2:1251044-1251066 GGCCTTCAGAACCACAATGATGG - Intronic
925114623 2:1367927-1367949 GTCACTCTGATCCCCACTGGAGG - Intergenic
927028771 2:19098810-19098832 GTTCCTTTGTATCACACTGAGGG - Intergenic
927370190 2:22345535-22345557 CTCCCTCTGTACCACACTTGAGG + Intergenic
929392323 2:41484242-41484264 GTTCCTCTGAACAATACTGAAGG - Intergenic
932327349 2:70871886-70871908 GGCCCTTGGTACCACACTGATGG - Intergenic
932369812 2:71177659-71177681 GTCCCTCTGGCAAACACTGAAGG - Intergenic
933617134 2:84494075-84494097 TTCCCTGTCAGCCACACTGAGGG + Intergenic
940452694 2:153859668-153859690 TTCACCCTGAACCACACAGATGG + Intergenic
941636425 2:167939927-167939949 GTCCCTCTGAGCCAAATGGAGGG - Intergenic
946013942 2:216588827-216588849 GTGCCTGTGAAACTCACTGATGG + Intergenic
947117642 2:226789564-226789586 GTCTCACTGAAGAACACTGATGG + Intronic
948733989 2:239986932-239986954 ATCCCTCAAAACCACATTGAGGG + Intronic
1169824859 20:9756357-9756379 TACCCTCTGAGCTACACTGAAGG - Intronic
1176032032 20:63017346-63017368 GCCCCTCTGCAGCCCACTGAGGG - Intergenic
1184993858 22:48188343-48188365 GTCCCCCTGGGCCCCACTGATGG + Intergenic
950964310 3:17135831-17135853 GTCCCACTGCACAACACTGCTGG + Intergenic
953799488 3:46011431-46011453 GTCCCTCCAAGCCACACTGATGG + Intergenic
954065997 3:48106588-48106610 GTCCATCTGACCCTCACTGGTGG + Intergenic
954642954 3:52113014-52113036 GTGCCTCAGAATCACTCTGAGGG - Intronic
955073333 3:55589897-55589919 GGCCCTGTGCAGCACACTGAAGG + Intronic
958706502 3:97663057-97663079 TTGCCTCTGAACAACTCTGAGGG + Intronic
961213780 3:125144429-125144451 GTCCCTCTGGACCCCTCTGCAGG - Intronic
962367166 3:134794340-134794362 GTCCTTCCCACCCACACTGAAGG + Intronic
965837871 3:172871104-172871126 ATCACTCTGAATCCCACTGATGG + Intergenic
967390749 3:188951601-188951623 GTCTCACTGAAACACACTGTGGG - Intronic
968570063 4:1334619-1334641 CTCCCTCTTTACCACACTGCAGG - Intronic
970969699 4:21967565-21967587 TACCCTCTGACTCACACTGAGGG - Intergenic
976018041 4:80584015-80584037 CTCTCTCTGAACTACATTGAGGG - Intronic
981118326 4:141018255-141018277 GTCTTTCTGAACCACACTGGTGG - Intronic
982464959 4:155718722-155718744 GTCCCACTGAACAAGACTGGTGG + Intronic
986644061 5:9899203-9899225 GTCCCTCTGAACTCCTCTGGTGG - Intergenic
992482275 5:77163951-77163973 GTCCCTGTTAAGGACACTGAAGG + Intergenic
993198277 5:84779319-84779341 GACCCTCTGATGCACTCTGAAGG + Intergenic
993428324 5:87798834-87798856 CTCCTTCTGACCAACACTGATGG + Intergenic
997734426 5:136202986-136203008 CTCACTCTGAATCACAATGAAGG + Intergenic
1002194709 5:177495592-177495614 GGCCCCCTGAACCCCACTGGTGG - Intronic
1002334840 5:178470500-178470522 GGCCCTCTGCTCGACACTGACGG - Intronic
1006201756 6:32299405-32299427 GTCCCTCTGAATCATATTAATGG - Intronic
1009964415 6:70563630-70563652 GGCCCTCTGCATCACACTGTGGG - Intergenic
1011259679 6:85457858-85457880 GTTCCTCTTAACTACACAGAGGG + Intronic
1011739525 6:90345970-90345992 GTCCCTGGGAACCACACCTATGG - Intergenic
1013072987 6:106745884-106745906 GCTCCTGTGTACCACACTGAGGG + Intergenic
1018090230 6:160340315-160340337 AATCCTCAGAACCACACTGATGG - Intergenic
1019824557 7:3273056-3273078 GCCCCTCTGAGCCACTCTTATGG + Intergenic
1023433674 7:40120047-40120069 GTCCCTCTAAATCACAAAGATGG - Intergenic
1025257446 7:57394225-57394247 GTCCCTCTGCACTACTCAGAAGG + Intergenic
1026556876 7:71416099-71416121 GCCCCTCTCAACCACAATGCAGG - Intronic
1026772757 7:73212644-73212666 GTCCCTCTGGGACTCACTGAGGG - Intergenic
1027013621 7:74766044-74766066 GTCCCTCTGGGACTCACTGAGGG - Intergenic
1027074417 7:75179989-75180011 GTCCCTCTGGGACTCACTGAGGG + Intergenic
1027690609 7:81340215-81340237 ATGCCTTTGAACAACACTGATGG - Intergenic
1030277038 7:107732838-107732860 GTTCCTCTGAACCACACTCCTGG - Intergenic
1032217690 7:129970264-129970286 GACCTTCTGAAACACACTCAGGG + Intergenic
1032844015 7:135737251-135737273 CTCCCTCTGATCCACCTTGAAGG + Intronic
1033144042 7:138855722-138855744 GTCAATCTCAACCACCCTGAAGG + Intronic
1038744229 8:30242668-30242690 AGCCATGTGAACCACACTGAAGG + Intergenic
1042214843 8:66420471-66420493 GTCCCTCTGAAGCTCACCCATGG + Intergenic
1044931849 8:97259211-97259233 CTGCCTCTGAACCCCAGTGACGG - Intergenic
1047517060 8:125564133-125564155 GTACCTCTGAACCCCACTGTTGG + Intergenic
1047781192 8:128112508-128112530 GTGCCTCTGACCCAGAATGAGGG - Intergenic
1049003115 8:139838563-139838585 GAGCCTCTGAACCACCCTGGCGG + Intronic
1052424269 9:28284164-28284186 CTTCCTCTGCACCTCACTGAGGG + Intronic
1054851697 9:69853065-69853087 ATTCCTCTGACCCACAGTGAAGG - Intronic
1054997274 9:71406932-71406954 GAAGCTCTGATCCACACTGAAGG + Intronic
1056093921 9:83231895-83231917 GTCCTTCTGCCCCACATTGAAGG + Intergenic
1061449511 9:130660751-130660773 GTCCCCCTGAAGCGCACTGTCGG + Intergenic
1061505514 9:131029690-131029712 GTCCCTCTGACCCCCAAGGAAGG + Intronic
1185585222 X:1237966-1237988 GTTCATCTTACCCACACTGATGG + Intergenic
1185840847 X:3390041-3390063 GAGCCTATGGACCACACTGAAGG + Intergenic
1192263866 X:69525266-69525288 GGACCTCTGAGTCACACTGATGG + Intronic
1196304691 X:114087401-114087423 GTCCCTGTGGACCACCCTGAGGG + Intergenic