ID: 914248371

View in Genome Browser
Species Human (GRCh38)
Location 1:145902106-145902128
Sequence GAGGGTCTGCTGGGCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914248366_914248371 -3 Left 914248366 1:145902086-145902108 CCAGGAGTGAAAAGATCACTGAG 0: 1
1: 0
2: 1
3: 18
4: 173
Right 914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG 0: 1
1: 0
2: 4
3: 40
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914248371 Original CRISPR GAGGGTCTGCTGGGCTCAGT TGG Intronic
900380446 1:2381510-2381532 GAGGGTGTGCGGGCCTCGGTTGG + Intronic
900406218 1:2494170-2494192 GAGGGGCTGCAGGGGTCAGGTGG + Intronic
900427891 1:2588755-2588777 GCGTGTCTGCTGGGCTGAGTGGG + Intronic
900599914 1:3498538-3498560 CAGGGTCTCCTGGGCCCAGGAGG - Intronic
901151224 1:7103101-7103123 GAGGGGCTGCGGGGTGCAGTGGG + Intronic
901397265 1:8990293-8990315 AAGGGTCTCCAGGGCTCTGTAGG + Intergenic
902196875 1:14804443-14804465 GAGGGTCTGTTGGGCTAACTCGG + Intronic
902747585 1:18483677-18483699 GAGGGGCTGCTGGGGTCAACTGG - Exonic
904140024 1:28345726-28345748 GAGAATCACCTGGGCTCAGTAGG + Intergenic
904485978 1:30824750-30824772 GGGGGTCTATGGGGCTCAGTCGG - Intergenic
905239113 1:36571134-36571156 GAGGGACAGCTGGGCTGAGGTGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906069607 1:43007506-43007528 CGGGGGCTGCTGGGCACAGTAGG - Intergenic
906310993 1:44754381-44754403 GAGGGGCTGCAGGGCACAATTGG + Intronic
907303400 1:53501731-53501753 GTGGGGCTGGTGGTCTCAGTGGG + Intergenic
909397566 1:75187557-75187579 GAGGCTCTGGTGGGTTCATTTGG + Intergenic
909492294 1:76239017-76239039 AAGGGGCTGCTGGGCTCCATTGG + Intronic
914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG + Intronic
916117443 1:161499034-161499056 GTGGGTTGACTGGGCTCAGTTGG - Intergenic
917645797 1:177027463-177027485 GAGTTTCTGCTTGCCTCAGTGGG - Intronic
919491782 1:198213326-198213348 GATGCAGTGCTGGGCTCAGTGGG + Intronic
919914215 1:202130029-202130051 AAGGGTCTGCCGGGGGCAGTGGG - Exonic
920224008 1:204424837-204424859 GTGGCTCTGCTGGGCTCACAAGG + Exonic
920442000 1:205986950-205986972 AAGGGTCTGCTGAGATCAGCTGG - Intronic
921337823 1:214106439-214106461 ATGGGTCTCCTTGGCTCAGTGGG + Intergenic
921810005 1:219501944-219501966 GTGGGTTGGCTGGACTCAGTTGG + Intergenic
922466141 1:225846496-225846518 GAGGGACTGCTGGGCTGGGGAGG + Exonic
922758555 1:228109831-228109853 GAGGATCCGCGGGGCTGAGTGGG + Intergenic
924174539 1:241377024-241377046 GTGGCTCTGCTGGGTCCAGTGGG - Intergenic
924442710 1:244099797-244099819 GAGGCTTTGCTGGGCGCCGTGGG - Intergenic
924793052 1:247270501-247270523 CAGGGCCTGCTGGGGTCTGTGGG - Intergenic
924797008 1:247300007-247300029 GTGGGACTGATGGGCTCAGTGGG - Exonic
1062823133 10:549594-549616 GAGGGTCTGGTGGCTTCAGAGGG + Intronic
1063483650 10:6399436-6399458 CAAGGGCTGCTGGGCTCAGCCGG - Intergenic
1064294727 10:14068227-14068249 GAGGCTCAGCTGGTATCAGTAGG + Intronic
1067134672 10:43597367-43597389 GAGGGTCTCTTGAGCTCAGGAGG - Intergenic
1067877333 10:50018229-50018251 GAGGGCCTGCTGGGGTCCATGGG + Intergenic
1068520126 10:58068602-58068624 GTGGGTTTGGGGGGCTCAGTGGG + Intergenic
1068905754 10:62320042-62320064 GTGGGTTGGCTGGGCTCAGTTGG + Intergenic
1069212642 10:65780276-65780298 CAGGGGCTGCTGGGCTGAGTGGG + Intergenic
1072032980 10:91539099-91539121 GAGGGTCTGCAGGGCACACCTGG - Intergenic
1072079136 10:92010964-92010986 AAGGGAATGCTGGGCTTAGTGGG + Intronic
1073055173 10:100695406-100695428 GGGGGTTGGCTGGGCTCAGCTGG - Intergenic
1073146618 10:101285647-101285669 GGGGAGCTCCTGGGCTCAGTGGG + Intergenic
1073146626 10:101285669-101285691 GGGGAGCTCCTGGGCTCAGTGGG + Intergenic
1073319471 10:102605804-102605826 GAGGTTGGGCTGGGCTCAGCAGG + Intronic
1075345688 10:121680544-121680566 GAGTGTGTCCTTGGCTCAGTGGG + Intergenic
1076712663 10:132347296-132347318 GAGGGTCAGGCGTGCTCAGTGGG + Intronic
1077080177 11:721551-721573 GAGGATTTGCTGGGGTCAGAGGG - Exonic
1077159159 11:1104852-1104874 GATGTTCTGCTGGGCACAGAGGG - Intergenic
1077174570 11:1182850-1182872 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077174785 11:1183969-1183991 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077385132 11:2265924-2265946 GCGAGTCTCCTGGGCACAGTGGG - Intergenic
1077437769 11:2550974-2550996 GAGGCTGTGCTGAGCTCAGTGGG + Intronic
1077561202 11:3262693-3262715 GAGAGGCTGCAGGGCACAGTGGG - Intergenic
1078184344 11:9039074-9039096 TAGGGTCTCCTGGGCTCAAGTGG + Intronic
1078491847 11:11776796-11776818 GAGGGTTTGCTGGGCCCTTTAGG - Intergenic
1078594414 11:12674459-12674481 GAGGCTCGGCTCGGCTCAGGCGG - Intergenic
1078781391 11:14442388-14442410 GAGGGTCTGATAGGCTGAGCTGG + Intergenic
1078920645 11:15827075-15827097 GAGGGTCAACTGGGACCAGTGGG + Intergenic
1080115447 11:28616649-28616671 GAGGTTCTGCTGAACTCATTTGG - Intergenic
1081432650 11:42993429-42993451 GAGGGTCGATTGAGCTCAGTAGG - Intergenic
1081720909 11:45287483-45287505 ATGGGTTGGCTGGGCTCAGTTGG + Intergenic
1083233606 11:61338401-61338423 GTGGGTCTGCTGGGCTTGGAGGG - Intronic
1083631383 11:64097223-64097245 GAGGGACTGCTGGGTCCAGTGGG + Intronic
1083749319 11:64752714-64752736 GAAGGCCTGCTGGGGTCAGGTGG - Intronic
1084105807 11:66979527-66979549 ATGGGTTGGCTGGGCTCAGTTGG - Intergenic
1084530566 11:69725396-69725418 AAGGATCGGCTGGGCTCAGAAGG + Intergenic
1084651458 11:70491847-70491869 CAGTGGCTGCTGGGCGCAGTGGG - Intronic
1084889287 11:72228786-72228808 AGGGGACTGCTGGGCCCAGTGGG - Exonic
1084890005 11:72232124-72232146 CAGCGTCTGGTGGGCTCAGCGGG + Intronic
1085306040 11:75486642-75486664 GAGGGGCTGCAGGGCTAAGGTGG - Intronic
1087192934 11:95274844-95274866 GAGGCTGTGTTGAGCTCAGTGGG + Intergenic
1087388490 11:97504625-97504647 CAGAGTCGGCTGGGCGCAGTGGG + Intergenic
1088866860 11:113856003-113856025 GAAAGTCTGCTGGTCTCAGCAGG - Intronic
1091283006 11:134392593-134392615 GAGGATCTGTTGAGCCCAGTAGG - Intronic
1091301839 11:134512926-134512948 CAGTGTCTGCTGGGGTGAGTCGG - Intergenic
1091544431 12:1491887-1491909 GAGTGTCTGCTGGGTTCTGGTGG - Exonic
1093771872 12:23027513-23027535 GGGGCTCTGCTGGGCTCAACAGG - Intergenic
1094361716 12:29638297-29638319 CAGTGTCTGCTGGGGTCTGTCGG - Intronic
1094551604 12:31456992-31457014 GAGGATCTCCTGAGCTCAGGAGG + Intronic
1094847254 12:34366717-34366739 GTGGGGCTGCGGGGCTCTGTGGG + Intergenic
1096033905 12:48446492-48446514 GAAGGGCTGCTGGGTTAAGTTGG + Intergenic
1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG + Exonic
1096523641 12:52198174-52198196 TAGGCTGTGCTGGGCTCACTGGG + Intergenic
1097601878 12:61703185-61703207 GAGGGTCTGCTGGTCTTGGCTGG - Intergenic
1101238190 12:102811298-102811320 GAGGGTCTGCTGCCCCCAGGTGG + Intergenic
1102082861 12:110112486-110112508 GTGGGTTAGCTGGGCTCAGCTGG - Intergenic
1103966058 12:124640401-124640423 GAGAGGCTGCTGGCCTCACTTGG + Intergenic
1104457073 12:128924022-128924044 GTGTGTCCGCTGGGCTCACTTGG + Intronic
1104502796 12:129302559-129302581 GTGGGTCAGCTGGGCTTAGAAGG + Intronic
1104898917 12:132177394-132177416 GATGGGTTGCTGGGCTCCGTGGG + Intergenic
1104951814 12:132444498-132444520 GGGGGTCTGCTGGGCTCCACCGG + Intergenic
1105211310 13:18258658-18258680 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
1106812967 13:33378227-33378249 GAGTCTCAGCTGGTCTCAGTAGG - Intergenic
1107620583 13:42225009-42225031 GAGGGTCACCTGAGCTCAGGAGG - Intronic
1107888305 13:44892587-44892609 GAGGGTCAGCTGAGCCCAGGAGG + Intergenic
1108495994 13:51025989-51026011 GAAGGTCTGCAGGGCTCAAAGGG - Intergenic
1109269210 13:60235633-60235655 GAGGGTTTACTGGGCTCAGTTGG - Intergenic
1110546724 13:76764594-76764616 GAGGGTTTTCAGGGCCCAGTGGG - Intergenic
1112409776 13:99153006-99153028 GTGGGTTGGCTGGGCTCAGTTGG - Intergenic
1114237146 14:20833485-20833507 GGGGGTCTGTTGGGCGGAGTAGG + Intergenic
1116790593 14:49335834-49335856 GGTGGTCTGCTGGTCTCACTTGG - Intergenic
1118056381 14:62083521-62083543 CAGGTTCTCCTGGGCTCACTTGG + Intronic
1119746272 14:77046444-77046466 GAGGTTCTCCTGGCCACAGTGGG - Intergenic
1120211472 14:81637942-81637964 CAGGGTCAGCTGGGCTCACACGG + Intergenic
1121272161 14:92645028-92645050 GAGGGTTAGCTGGGCTTTGTGGG + Intronic
1122244690 14:100394215-100394237 AAGAGTCTGCTGGGGTCACTGGG - Intronic
1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG + Intronic
1122895486 14:104754590-104754612 GGAGGTCTGCTGGGTGCAGTGGG + Intronic
1123667558 15:22619955-22619977 AAGGGTATGCAGGGCTGAGTTGG - Intergenic
1124321403 15:28714518-28714540 AAGGGTATGCAGGGCTGAGTTGG - Intronic
1124481104 15:30080830-30080852 AAGGGTATGCAGGGCTGAGTTGG + Intergenic
1124522496 15:30416340-30416362 AAGGGTATGCAGGGCTGAGTTGG - Intergenic
1124536168 15:30549874-30549896 AAGGGTATGCAGGGCTGAGTTGG + Intergenic
1124627291 15:31315574-31315596 GAGGGAAAGCTGGGCTCAGCTGG + Intergenic
1124776144 15:32591354-32591376 AAGGGTATGCAGGGCTGAGTTGG + Intergenic
1124886964 15:33696246-33696268 GATGATCTGCTGGGCCCAGGAGG + Exonic
1125737312 15:41935793-41935815 GTGGGTTGACTGGGCTCAGTTGG + Intronic
1126141738 15:45444926-45444948 CAGGGTCTGGTGGGCTGAGAAGG - Intronic
1126355144 15:47787500-47787522 GAGTGACTGCAGGGCTCAGAAGG - Intergenic
1126856576 15:52845204-52845226 TAGGATCTGCTGGGCTGAGCAGG - Intergenic
1128525879 15:68411987-68412009 GTGGCTCTGCTGGGCTCACTGGG - Intronic
1128795881 15:70466302-70466324 GGGGGTCTGCAGGGCTGAGCAGG - Intergenic
1129798693 15:78397256-78397278 CAGCGTCTGCGGGGCTCTGTTGG + Intergenic
1130042004 15:80413156-80413178 GAGCCTCTGATGGCCTCAGTGGG + Intronic
1130537527 15:84798020-84798042 GAGGGTCTGTGGGGCTGGGTGGG - Exonic
1131119390 15:89813566-89813588 GAGGGTGTGCTGGGCCCATGAGG - Intronic
1131710755 15:95053729-95053751 GATGGTCTCCTGGATTCAGTTGG + Intergenic
1132666322 16:1082840-1082862 CGGGGTCTGATGGCCTCAGTGGG + Intergenic
1132669213 16:1095852-1095874 CAGGGTCTGCTGAGCTCATGGGG - Intronic
1132675596 16:1120056-1120078 CAGGGTCTGGTGGCCTCAGGTGG - Intergenic
1134537096 16:15034808-15034830 GAGAGTCTGCACGGCTGAGTGGG - Intronic
1134660204 16:15978274-15978296 GAGGATCTCCTGAGCTCAGGAGG + Intronic
1134766213 16:16760461-16760483 GTGGTTCTGCTGGGCTCTGTTGG + Intergenic
1134979838 16:18598750-18598772 GTGATTCTGCTGGGCTCTGTTGG - Intergenic
1137680345 16:50337702-50337724 AAGGGTGTGCTGGGCTCTCTTGG + Intronic
1139507483 16:67406360-67406382 GAGGGTCCGCTGGGCTGTGCCGG + Exonic
1142256974 16:89018758-89018780 GAGGCTGGGCTGGGCTCAGGAGG - Intergenic
1203138351 16_KI270728v1_random:1744547-1744569 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1142849191 17:2696130-2696152 GAGGGGCTGCGGGGCTGGGTGGG - Intronic
1143399965 17:6637582-6637604 GTGGGGCTGCTGGGGTCTGTGGG - Intronic
1144824532 17:18098364-18098386 GTGGGTGTGCTGGGCCCAGAAGG + Intronic
1145007331 17:19345015-19345037 TGGGATCTGCTGGGCACAGTGGG - Intronic
1145285823 17:21505516-21505538 GAAGGTCTGCTGGGGTGACTAGG + Intergenic
1145391776 17:22460784-22460806 GAAGGTCTGCTGGGGTGATTAGG - Intergenic
1146207840 17:30920400-30920422 GAGAGTCAGCTGGGGTCAGGGGG - Intronic
1147133061 17:38420091-38420113 GAGTGTGGGCTGGGCTCAGTGGG + Intergenic
1149817517 17:59740497-59740519 GATTGTCTGCTTGGCTCAGAAGG + Intronic
1150067109 17:62120214-62120236 GAACGTCTGCTGGGGTGAGTTGG + Intergenic
1150795523 17:68233809-68233831 GAGGATCGCCTGGGCTCAGGAGG - Intergenic
1151450315 17:74194720-74194742 GAGGGGCTGCTGGCCTCTGCGGG + Intergenic
1151761405 17:76105190-76105212 GAGGGTGTTTTGGGCTCAGGTGG + Intronic
1151896133 17:76982124-76982146 CAGTCTCTCCTGGGCTCAGTAGG + Intergenic
1153278236 18:3390148-3390170 GTGGGTTAACTGGGCTCAGTTGG + Intergenic
1153713187 18:7820301-7820323 GAGGGCCTGCTCTGCTCAGAGGG + Intronic
1154163820 18:11999246-11999268 CAGGGTCTGCCGGGGTCAGGGGG + Intronic
1154322988 18:13369392-13369414 GGGGGCCTGTTGGCCTCAGTGGG + Intronic
1155334790 18:24752600-24752622 TAGGGACTCCTGGGCTCAGCAGG + Intergenic
1156455103 18:37288655-37288677 GAGGCCCTGCTGAGCTCAGGAGG + Intronic
1157463635 18:47925383-47925405 GTGGTTCTCCTTGGCTCAGTGGG - Intronic
1157782655 18:50453860-50453882 GAGGGTCTGTTGGCCAGAGTTGG + Intergenic
1159014179 18:63088321-63088343 CAGGGCCTGCTGGGGGCAGTGGG - Intergenic
1162384436 19:10352881-10352903 GAGGGGGTGCTGGGGTCACTTGG - Intronic
1162545168 19:11324831-11324853 GAGGGTCTGCAGGGGTCAAAGGG + Exonic
1163235043 19:16025064-16025086 GAGGACCTAATGGGCTCAGTTGG + Intergenic
1163580732 19:18137204-18137226 GAGGACCTGCAGGGCTCAGCGGG + Intronic
1164978910 19:32597838-32597860 GAGGGTTTGTTGGTCACAGTGGG - Exonic
1165060871 19:33204689-33204711 GTGGGGCTGCTGGGCCCAGCAGG - Exonic
1165146560 19:33734753-33734775 GGTGGTATGCTGGGCCCAGTGGG - Intronic
1167095886 19:47374997-47375019 GAGGGTCTGTTGGGTCCAGATGG + Intronic
1167487750 19:49773060-49773082 GAGGATCTGAAGGGCACAGTGGG + Intronic
1167498676 19:49833653-49833675 GTGGGTCACCTGGGCTCAGTGGG + Intronic
1168287869 19:55343340-55343362 GAGGGTCTGGTGGGGCGAGTAGG + Intronic
1168474443 19:56665711-56665733 GAGGATCAGCTGAGCTCAGAAGG + Intronic
925133791 2:1512598-1512620 GAGGGGCTGCAGGGCTCAGCGGG - Intronic
928815639 2:35292008-35292030 GATGCAGTGCTGGGCTCAGTGGG - Intergenic
929079751 2:38110581-38110603 GAGGGTCGGCCGTGCTCAGCTGG + Intergenic
929499660 2:42479554-42479576 GAGGGTCGCTTGAGCTCAGTAGG + Intronic
930847068 2:55917743-55917765 GAGGGTCAGCTGGGTTCCGCCGG + Exonic
932888873 2:75572854-75572876 GTGGGTTTACTGGGATCAGTTGG - Intergenic
934665212 2:96164740-96164762 GAAGGGCTGCTGGGATCAGCCGG - Intergenic
934865307 2:97804376-97804398 GGGGGTGGGCTGGGCACAGTGGG + Intronic
937098405 2:119250509-119250531 GAGGCTCTGCGGGGCTCCCTGGG + Intronic
938098984 2:128485230-128485252 GAGTGGCTGCTTGGCTCAATAGG + Intergenic
938758681 2:134403816-134403838 GAGGGTCTGATTGGCACAGATGG + Intronic
942519780 2:176791325-176791347 GAGGCTCTGCTGAGCACAGGTGG - Intergenic
945250461 2:207761602-207761624 GAGGGACTGTTGGGCTTAGAAGG - Intronic
946299106 2:218811651-218811673 CATGCTCTGCTTGGCTCAGTGGG - Intronic
946979493 2:225193311-225193333 GAAGTTCTGCTTAGCTCAGTGGG + Intergenic
947367557 2:229412785-229412807 GAGGGACCCCAGGGCTCAGTGGG + Intronic
947727282 2:232408415-232408437 GTGGGTGTGCTGGGCACAGCAGG + Intronic
948080903 2:235204382-235204404 GTGGCTCTGCTGTGCTCAGCTGG + Intergenic
948305519 2:236944376-236944398 TAGGGGCTGGTTGGCTCAGTGGG + Intergenic
948564993 2:238879252-238879274 AGGGCTCTGCTGGGCTGAGTGGG + Intronic
949043767 2:241860937-241860959 GAGGGTCTGCAGGGCTGCGAGGG + Intergenic
1168911598 20:1452428-1452450 CAGGGTCTGCTGGGCTTGGCAGG + Intronic
1169262061 20:4146528-4146550 GGGGGTTTGCTGGACTCAGCTGG - Intronic
1169279358 20:4253988-4254010 CAGGGTCTCCAGGGCTCACTGGG - Intergenic
1171023473 20:21608028-21608050 GTGGCTCTGCTGGGCACAGAAGG - Intergenic
1171486478 20:25489817-25489839 GAGGGCCTGCTGGGCAGAGTGGG - Intronic
1173838233 20:46139435-46139457 AAGGGTCTGCTGGGGCCACTGGG + Intergenic
1175516751 20:59575062-59575084 CAGTGTCTGCTGGCCTCAGACGG + Intergenic
1175536771 20:59720254-59720276 GGTGGTCTGCTGGGCTCTGCAGG + Intronic
1175643018 20:60647364-60647386 GAGTTTCTGCTGGTCTCAGGAGG + Intergenic
1175743786 20:61439352-61439374 GAGGGTTGGCTGGGCTCAGCTGG + Intronic
1176120783 20:63453653-63453675 GTGGCTCTGCTGGGCTGAGCTGG - Intronic
1179099948 21:38347662-38347684 GAGGATGTGCTGGGCTGAGGAGG - Intergenic
1179238031 21:39564370-39564392 GAGGGGAGGCTGGGCACAGTCGG - Intronic
1179611670 21:42555985-42556007 GAGTGACCGCTGGGCTCAGTGGG + Intronic
1180764925 22:18340779-18340801 GAGGCTCTGAGGGGCTCAGAGGG - Intergenic
1180814106 22:18778905-18778927 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
1181051451 22:20240105-20240127 AAGGGTCTCCTGGGCCCAGAGGG + Intergenic
1181200289 22:21213240-21213262 GAGGCTCTGAGGGGCTCAGAGGG + Intronic
1181311213 22:21945931-21945953 GAGGGTCCTCTGGGTTCAGCAGG + Exonic
1181701449 22:24623719-24623741 GAGGCTCTGAGGGGCTCAGAGGG - Intronic
1182658091 22:31905614-31905636 GAAGGTCTGCTGGGATGGGTAGG + Intronic
1183036469 22:35144405-35144427 AAGAGTCTGCTGGGCTGAGAAGG - Intergenic
1183382128 22:37495571-37495593 TAGGAGCTGCTGGGCTCTGTGGG + Exonic
1184390838 22:44202228-44202250 GAGGGGTGGCAGGGCTCAGTGGG + Intronic
1184525998 22:45023204-45023226 CAGGGTCTGCGGGGGGCAGTGGG - Intergenic
1184762613 22:46553302-46553324 GTGGGTTGGCTGGGCTCAGCTGG - Intergenic
1184972019 22:48029691-48029713 GAGGATCAGCTGAGCTCAGGAGG + Intergenic
1203226547 22_KI270731v1_random:81684-81706 GAGGCTCTGAGGGGCTCAGAGGG - Intergenic
1203264203 22_KI270734v1_random:4592-4614 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
954116078 3:48467508-48467530 GAGGGGCTGCTGGCCCCACTGGG + Exonic
954663134 3:52236748-52236770 AAGGGTCTGCTGAGCTCAGTTGG - Intronic
955309088 3:57866180-57866202 GAGGGTCAGCTGAGCCCAGGAGG + Intronic
955359898 3:58264599-58264621 GAGGGTCAGTTGGGCTTAGGAGG + Intronic
956163062 3:66374789-66374811 GAGGGTCACCTGAGCTCAGCAGG + Intronic
956819495 3:72940769-72940791 GAGGGTCCTCTGAGCTCAGGAGG - Intronic
958584343 3:96068235-96068257 CACAGTCTGCTGGGCTGAGTAGG - Intergenic
959597734 3:108146337-108146359 GTGGGTCGGCTGGGCTCCGCAGG - Intergenic
961165380 3:124759986-124760008 GAGGGTCTGAAGGCCTGAGTAGG + Intergenic
962316021 3:134359987-134360009 GAGGGACTGCTGAGCTCTATGGG + Intronic
962367773 3:134797178-134797200 CAGGGACTGCTGGGCTTTGTAGG + Intronic
964511665 3:157459235-157459257 TAGGGTCTGCTGGGCTCGCATGG + Intronic
965038415 3:163472485-163472507 GATGTGCTGCTGGGTTCAGTTGG + Intergenic
965628181 3:170703402-170703424 GGGTCTCTGCTGGGCTCAGTTGG + Intronic
966551790 3:181213570-181213592 GGTGGTGTGCTGGGCTGAGTGGG + Intergenic
968086882 3:195877794-195877816 GAGGGGGTGGTGGGCTCAGCAGG + Intronic
968504867 4:967086-967108 CAGGGTCTGCTGGGCGGGGTGGG - Intronic
968572297 4:1348225-1348247 GTGTGTGTCCTGGGCTCAGTGGG - Intronic
969373553 4:6748834-6748856 GGGGGGCTGCTGGATTCAGTGGG - Intergenic
972783758 4:42308587-42308609 GAGGGTGTGCTGGTGGCAGTGGG - Intergenic
975033576 4:69655184-69655206 AAGTTTGTGCTGGGCTCAGTTGG + Intergenic
976670745 4:87649969-87649991 TTGGGTCTGCTGGGATCTGTCGG + Intergenic
979929256 4:126610371-126610393 AAGGGTCTGCTGGACTATGTTGG + Intergenic
980752918 4:137115817-137115839 AAAGGTTTGCTGGGCTCAGCTGG + Intergenic
983536378 4:168861743-168861765 GAGGATCAACTGGGCTCAGGAGG - Intronic
987714427 5:21548368-21548390 GAAGTTCTGCTGGTCTCACTTGG + Intergenic
990874478 5:60468814-60468836 GAGGGAAGGCTGGGCACAGTGGG - Intronic
991092471 5:62706386-62706408 GAGGGTCTGATGGGGCCACTTGG - Intergenic
991411151 5:66346974-66346996 GTGGGTCTGCTGGGGTCGGAGGG + Intergenic
995240819 5:109884229-109884251 GAGGGTCCCCTGGGCTCCGTGGG - Intronic
997042664 5:130277088-130277110 TAGGGGCTGCTGGGCTCATTCGG + Intergenic
997525435 5:134549960-134549982 GAGACTCTCCTGAGCTCAGTAGG - Intronic
999683365 5:154080704-154080726 GAAGGCCTGCTGGGCCCAGGTGG - Intronic
1000802283 5:165743263-165743285 GAGGGTCAGCTGAGCCCAGAAGG - Intergenic
1001774599 5:174319788-174319810 AAGGGTCAGCTTGGCTGAGTGGG + Intergenic
1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG + Intergenic
1003189929 6:3865672-3865694 GTGGGTCTGTTGGGCTTAGCTGG - Intergenic
1004550897 6:16646130-16646152 GAGGATCACCTGGGCTCAGGAGG + Intronic
1004593169 6:17073431-17073453 GGGAGTCTCCTGGTCTCAGTTGG - Intergenic
1004770601 6:18776966-18776988 GAGGATCACCTGGGCTCAGGAGG - Intergenic
1005273019 6:24186617-24186639 GAGGGGCTGCTGGGCTGAGCTGG + Intronic
1006130323 6:31865229-31865251 GTGGGTGTGCTGTGCTCAGTCGG - Intronic
1006638994 6:35479435-35479457 GAGGGTCTGCTGAGCTTCCTTGG - Intronic
1007097580 6:39223341-39223363 GAGGATGTGCTGCCCTCAGTAGG - Intronic
1007332775 6:41126730-41126752 AAGGTTCTGCTGGGCTGAGAAGG - Intergenic
1007395543 6:41575739-41575761 GAGGGGCTCCTGGGGGCAGTTGG - Intronic
1009002299 6:57733717-57733739 GAAGTTCTGCTGGTCTCACTTGG - Intergenic
1010705607 6:79105626-79105648 GATGGGCTGCTGAGCTGAGTAGG - Intergenic
1013170288 6:107631528-107631550 GAGGGTCTGATGGATTCTGTGGG + Intronic
1014735968 6:125096657-125096679 TAGCTTCTGCTGGGCGCAGTGGG - Intergenic
1015227321 6:130872792-130872814 GTGGGTCGGTTGTGCTCAGTTGG - Intronic
1015302673 6:131671632-131671654 GAGGGTCTGCTGGGAACAGTAGG + Intronic
1016055488 6:139573863-139573885 GGTGCTCTGCTGGGCTCAGTGGG + Intergenic
1016210962 6:141532437-141532459 GTGGTCCTGCTGGGCTGAGTGGG + Intergenic
1016802512 6:148181218-148181240 GAGGGTTGACTGGGCTCAGTGGG - Intergenic
1017538331 6:155372532-155372554 GAGGGTCTGCTGTCCTCGGGAGG - Intergenic
1019656312 7:2197960-2197982 GAGGGGCTGATGGGCCCTGTGGG - Intronic
1021953279 7:25796970-25796992 GAGGCTCTTCTGGGCTCAGCTGG - Intergenic
1022003389 7:26246165-26246187 GAGAGTCTGTTGGGCGGAGTAGG - Intergenic
1022088239 7:27089286-27089308 CAGGTTCTGCTGAGATCAGTAGG + Intergenic
1023321310 7:39000795-39000817 GAGGGTCTCCTGTGCACTGTTGG + Intronic
1023391166 7:39713174-39713196 CAGGGTATGCAGGGCTCAGCAGG + Intergenic
1023629975 7:42154304-42154326 GAGGGTGTGCAGTGCTGAGTGGG - Intronic
1023770894 7:43555776-43555798 GAGGGTCTGCTGAACTGAGTGGG - Intronic
1023984390 7:45086463-45086485 GTGGTTCAGCTGGGCTCGGTGGG + Intronic
1024896854 7:54270430-54270452 GTGGGTTTGCTGGGCTCTGCTGG - Intergenic
1025823783 7:64994885-64994907 AGGGGTCTGCTGGGCTGGGTAGG - Intronic
1026021329 7:66708720-66708742 GAGGATCTCCTGGGCCCAGGAGG + Intronic
1026885792 7:73943630-73943652 GAGGGTCCCCTGGGCCCAGGAGG + Intergenic
1027177770 7:75915434-75915456 GAGGGCCTGCCGGGCTCTCTCGG - Intronic
1028484011 7:91338668-91338690 GTGGGTTGGCTGGGCTCAGTTGG + Intergenic
1030809323 7:113955779-113955801 GTTGGTCTGCTGGCCTCACTTGG - Intronic
1031987668 7:128173691-128173713 GAGGGTCTGCCTGGCTGAGCTGG - Intergenic
1032437508 7:131912194-131912216 GAGGGTCTTCTGGGTTGAGGGGG - Intergenic
1032794007 7:135263247-135263269 GACAGCCTGCTGGGCTGAGTAGG - Intergenic
1032919138 7:136526674-136526696 TGGAGTCTGCTGGGCTGAGTGGG - Intergenic
1033511863 7:142067296-142067318 GGGGCTCTGTTGGGCTCTGTTGG + Intronic
1033514935 7:142096286-142096308 GGGGCTCTGTTGGGCTCTGTTGG + Intronic
1034115123 7:148577562-148577584 GAGGGGCTGGTTAGCTCAGTTGG - Intergenic
1035195769 7:157219145-157219167 TAGGGTCTGCTGGTCTGAGATGG + Intronic
1035789389 8:2289867-2289889 GAGGGTCTCGTGGGCTGAGTCGG - Intergenic
1035803416 8:2431838-2431860 GAGGGTCTCGTGGGCTGAGTCGG + Intergenic
1036640337 8:10579610-10579632 GAAGGTGCGCTGGGCCCAGTGGG - Intergenic
1036706925 8:11053116-11053138 CAGTGTCTGCGGGGCTCAGAAGG - Intronic
1037753777 8:21698755-21698777 GGGGGTCTGCTGTGCTGAGTGGG - Intronic
1037753785 8:21698795-21698817 GGGGGTCTGCTGTGCTGAGTGGG - Intronic
1038805146 8:30783558-30783580 GAGGATAGGCTGGGCACAGTGGG - Intronic
1039717859 8:40130329-40130351 GAGGGTCTCCTGAGCCCAGGAGG - Intergenic
1042724618 8:71860344-71860366 GAGGGCTTGCTCAGCTCAGTGGG - Intronic
1043518193 8:81016135-81016157 GAGGTTCTTCTGGTCTCAGTTGG - Intronic
1043857369 8:85277579-85277601 GAGGGGCTGCTGTGGACAGTAGG + Intronic
1048912864 8:139152791-139152813 GATGTTCTACAGGGCTCAGTGGG + Intergenic
1049368860 8:142253921-142253943 CAGGGTCTGGAGGGATCAGTGGG - Intronic
1049465428 8:142749252-142749274 GGGGGTCTGCAGGGCCCAGGAGG + Intergenic
1049492549 8:142913022-142913044 GAGGTTTGGCTGGGCTCAGCAGG - Intronic
1053514893 9:38722424-38722446 GAGGGTCTGGTGGGGTGAGAAGG + Intergenic
1056367379 9:85919136-85919158 GTGGGTGGGCTGGACTCAGTGGG + Intergenic
1056845047 9:90030382-90030404 AAGGGTCTGCTGGGTCCTGTAGG - Intergenic
1057198614 9:93128602-93128624 CAGGGGCTGCTGGCCACAGTGGG + Intronic
1057702031 9:97370304-97370326 GTGGGTGTGCTGGGTTCCGTGGG + Intronic
1058453910 9:105121509-105121531 GTGGGTTGGCTGGGCTCAGATGG + Intergenic
1058587975 9:106530898-106530920 CAGGGTCGGCTGGGCACAGTGGG - Intergenic
1058739694 9:107930686-107930708 GAGGATCTGCTGAGCCCAGGAGG + Intergenic
1058922369 9:109629103-109629125 GATGCTCTGCGGAGCTCAGTTGG + Intergenic
1060091076 9:120744083-120744105 CTGGGTCTGCTGGGCTCACCAGG - Intergenic
1060787568 9:126462743-126462765 GTGGGACTGCTGAGCTCAGGTGG + Intronic
1061034817 9:128107615-128107637 GAGGGTCTGCTGGGGTCAGCAGG - Exonic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1061198958 9:129125114-129125136 GATGCTCAGCTGTGCTCAGTGGG + Intronic
1061244585 9:129394899-129394921 GGGGGTCTGCTGGGCAGAGGGGG - Intergenic
1061748005 9:132754084-132754106 GAGTTTCTGCTGACCTCAGTGGG - Intronic
1062221645 9:135419274-135419296 GAGGGTGTGATGAGCTCAGAAGG - Intergenic
1062433119 9:136534876-136534898 GAGGGACTGGGGGGCTCTGTGGG - Intronic
1062433145 9:136534944-136534966 GAGGGACTGGGGGGCTCTGTGGG - Intronic
1062440117 9:136566040-136566062 GGGGGTCTGCTGGCCCCAGTGGG - Intergenic
1062523366 9:136968758-136968780 CAGAGACTGCTGGGCCCAGTGGG + Intergenic
1062618898 9:137410820-137410842 GGGGGTCTGCCAGGCTCTGTGGG - Intronic
1062618924 9:137410914-137410936 GGGGGTCTGCCAGGCTCTGTGGG - Intronic
1062634632 9:137484469-137484491 GTGGGTGGGCAGGGCTCAGTTGG - Intronic
1185533332 X:839215-839237 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533369 X:839385-839407 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533409 X:839555-839577 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533446 X:839725-839747 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533484 X:839895-839917 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533521 X:840065-840087 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533561 X:840235-840257 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533598 X:840405-840427 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533636 X:840575-840597 CAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185577019 X:1182541-1182563 GAAGGTCAGCTGGGCTCTTTAGG - Intergenic
1185814250 X:3139649-3139671 GAAGCTCTGAGGGGCTCAGTGGG + Intergenic
1186000277 X:5001820-5001842 AAGTCTGTGCTGGGCTCAGTGGG + Intergenic
1187175098 X:16888998-16889020 CAGGGTCTGCTGGGCAAACTCGG - Intergenic
1187662275 X:21562213-21562235 GTGGGTATGGTGGGCCCAGTGGG + Intronic
1187720717 X:22148098-22148120 GTGGGTTGGCTGGGCTCAGCTGG + Intronic
1188523495 X:31063672-31063694 GAGTGACTGCAGGGCCCAGTAGG + Intergenic
1189530875 X:41881537-41881559 CAGGGTCTTCTGGGCCCAGAGGG - Intronic
1190060859 X:47210931-47210953 TAGGGTCTTCTGGGGTCAGGTGG + Intronic
1193805095 X:85985355-85985377 CAGGGGCTGCTGGTCCCAGTTGG - Intronic
1194950371 X:100118839-100118861 GAGGATCTCTTGAGCTCAGTAGG + Intergenic
1197533919 X:127663879-127663901 GAGGAGTTGCTGGGCTGAGTAGG + Intergenic
1200038073 X:153346088-153346110 GAGGATCAGCTGGGCTCTCTGGG + Intronic