ID: 914249020

View in Genome Browser
Species Human (GRCh38)
Location 1:145906814-145906836
Sequence TTGGTAGTCACCTGGTTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914249014_914249020 17 Left 914249014 1:145906774-145906796 CCAGGTGCATATTCACAGCAGGA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 914249020 1:145906814-145906836 TTGGTAGTCACCTGGTTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 108
914249012_914249020 18 Left 914249012 1:145906773-145906795 CCCAGGTGCATATTCACAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 133
Right 914249020 1:145906814-145906836 TTGGTAGTCACCTGGTTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 108
914249011_914249020 19 Left 914249011 1:145906772-145906794 CCCCAGGTGCATATTCACAGCAG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 914249020 1:145906814-145906836 TTGGTAGTCACCTGGTTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914249020 Original CRISPR TTGGTAGTCACCTGGTTGGA AGG Exonic
903266745 1:22162524-22162546 GGGGCAGCCACCTGGTTGGAAGG - Intergenic
905228220 1:36493699-36493721 TTGATAGTTAGATGGTTGGATGG - Intergenic
905302796 1:36997164-36997186 TTGGTTGTGACTTGGTTGGGTGG - Intronic
905402731 1:37715407-37715429 TTGGGAGGCACCTGGATGAAGGG - Intronic
906198362 1:43943899-43943921 TTTGTAGTCCCCTGGTTTGAGGG - Intergenic
910725593 1:90335423-90335445 TTGATTGGCACCTGGTTAGAAGG - Intergenic
912675587 1:111677485-111677507 TTGAGAGTGACTTGGTTGGAGGG + Intronic
914249020 1:145906814-145906836 TTGGTAGTCACCTGGTTGGAAGG + Exonic
915494296 1:156270442-156270464 TTGGTATTCAGCTGATCGGAAGG - Intronic
917343280 1:174002989-174003011 TTAGTAGTCAACTGGTTATATGG - Intronic
923127495 1:231045165-231045187 TGGGTAGACTCCTGGTTGGTTGG + Intergenic
1064863356 10:19851726-19851748 TTGGTAAAAACCTGGTTTGACGG + Intronic
1065104980 10:22373979-22374001 TTGGTAGTTACCTAATTGGTTGG + Intronic
1069114894 10:64492653-64492675 TTGGTAGTTAAGAGGTTGGAGGG - Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1072623615 10:97096935-97096957 TTGGCAGACAGCTGGTTGGGCGG - Intronic
1074046257 10:109842138-109842160 TTGCTTGTCACCTGGTTGGGGGG - Intergenic
1088859244 11:113784463-113784485 TTGTTAGCCACCTGCTTTGAAGG + Intergenic
1089290442 11:117434737-117434759 TGAGTAGTTACATGGTTGGATGG - Intronic
1092215136 12:6676400-6676422 TTTGTAGTCTCCTGGGTGGATGG + Intronic
1092243434 12:6849654-6849676 TTGGAAAACACCTGTTTGGAGGG + Exonic
1093407081 12:18817759-18817781 TAGGTAGCCACCTCCTTGGAAGG + Intergenic
1100188255 12:92161076-92161098 TTGGAATTAACCTGGATGGAGGG + Intergenic
1101953931 12:109197363-109197385 TTTCTAGTAACCTGGTTGGTGGG + Intronic
1102150769 12:110688137-110688159 TTGGTAGTAACCTGGTGCCAGGG + Exonic
1106184732 13:27399374-27399396 TTGGTAGTGACCAGGGTGCAGGG - Intergenic
1106350135 13:28922022-28922044 TGGGTAGGGACCTGGTAGGAGGG + Intronic
1110736141 13:78939004-78939026 TTGTTTGTCCACTGGTTGGAAGG + Intergenic
1112708379 13:102098786-102098808 TTGGAGGTTACCTGGTTGCAGGG - Intronic
1113763742 13:112867863-112867885 TTGGGAGTATCCTGGTTGGAAGG - Intronic
1114941861 14:27623089-27623111 TTGGGAGGAACCTGGTGGGAGGG - Intergenic
1124258421 15:28164841-28164863 TTGGCAGTCTCCTGGTTTGAGGG - Intronic
1125612262 15:40979530-40979552 CTGGGAGTCCCCTGGGTGGAAGG + Exonic
1126309214 15:47296861-47296883 TTGGTAGGCACGTGGCTGGGTGG + Intronic
1126412496 15:48386595-48386617 TTGGCAGTCACCTGGTAGGCTGG - Intergenic
1128356751 15:66933388-66933410 TTTGTAGCCAACTGGTTAGAGGG - Intergenic
1129851359 15:78795715-78795737 TTAGCAGCCACCTGGTTGGCAGG - Intronic
1131019164 15:89083597-89083619 TTGAGAGTCACCTGGTGGGAGGG + Intergenic
1132285190 15:100657661-100657683 TTGGGAAACTCCTGGTTGGAAGG + Intergenic
1134327713 16:13222189-13222211 TTGGGAGGGACCTGGTGGGAGGG - Intronic
1135844410 16:25905628-25905650 TTGGTAGCCACCTGGATGTGAGG + Intronic
1136512038 16:30744027-30744049 TTGGAAGGATCCTGGTTGGAAGG + Intronic
1138254237 16:55539530-55539552 TTAGGAGTCACCTGGGTGAAAGG - Intronic
1139179254 16:64726433-64726455 TTGGTATAGACCTGGATGGAAGG - Intergenic
1144998033 17:19284259-19284281 TTGCTAGTGATCTGGTTGCATGG + Intronic
1149636024 17:58170088-58170110 GTGGTAGCCACCTGGGTGGGAGG + Exonic
1150265534 17:63830259-63830281 TTGGGTGTCACCTGGGTGAAGGG - Exonic
1151223651 17:72632373-72632395 CTGGCAGTCACGTGGTGGGAGGG - Intergenic
1152343539 17:79738169-79738191 GTGGGAGTCACCTGCTTGGCGGG - Intronic
1152542337 17:80982538-80982560 CTGGTGGACACCTGGGTGGAGGG + Intergenic
1157933760 18:51851977-51851999 TTTAAAGTCACCTGGTTGGGGGG + Intergenic
1159966431 18:74599656-74599678 TGGGTATTCACCTGGTTGAAGGG + Intronic
930645140 2:53898319-53898341 TTGGTAGACACCTTGCTAGATGG - Exonic
931029395 2:58155484-58155506 TTGGTAGTCTCCTGGTGGGAAGG + Intronic
937223591 2:120355777-120355799 TTAGCATTCACCTGGTTAGAAGG + Intergenic
938102107 2:128504369-128504391 TTGGGTGCCACCTGGTTGGAAGG + Intergenic
938581851 2:132653400-132653422 TGGGTATTTACCTGATTGGATGG - Intronic
938662549 2:133502669-133502691 GTGGGAGTCACCGGGGTGGAAGG - Intronic
939109095 2:137985594-137985616 TAGGTAGACAGCTGGTTAGACGG - Intronic
946145173 2:217725225-217725247 TTGGGACTCAGCTGGTTGCATGG + Intronic
948692992 2:239718730-239718752 TAGACAGTCACCTGGATGGATGG - Intergenic
948693027 2:239718922-239718944 TAGACAGTCACCTGGATGGATGG - Intergenic
948693036 2:239718970-239718992 TAGACAGTCACCTGGATGGATGG - Intergenic
948693050 2:239719050-239719072 TGGATGGTCACCTGGATGGATGG - Intergenic
948693054 2:239719066-239719088 TAGATAGTCACCTGGATGGATGG - Intergenic
948693087 2:239719258-239719280 TAGATAGTCACCTGGATGGATGG - Intergenic
948693112 2:239719386-239719408 TAGATAGTCACCTGGATGGATGG - Intergenic
948693130 2:239719482-239719504 TGGATGGTCACCTGGATGGATGG - Intergenic
948693134 2:239719498-239719520 TGGATGGTCACCTGGATGGATGG - Intergenic
948693146 2:239719561-239719583 TAGACAGTCACCTGGATGGATGG - Intergenic
948693166 2:239719657-239719679 TAGATAGTCACCTGGATGGATGG - Intergenic
948693190 2:239719785-239719807 TAGATAGTCACCTGGATGGATGG - Intergenic
948693199 2:239719833-239719855 TGGATGGTCACCTGGATGGATGG - Intergenic
948693203 2:239719849-239719871 TAGATAGTCACCTGGATGGATGG - Intergenic
948693213 2:239719897-239719919 TAGATGGTCACCTGGATGGATGG - Intergenic
948693248 2:239720057-239720079 TAGACAGTCACCTGGATGGATGG - Intergenic
948693258 2:239720117-239720139 TGGGTGGACACCTGGATGGATGG - Intergenic
948693277 2:239720209-239720231 TGGACAGTCACCTGGATGGACGG - Intergenic
1168830678 20:843807-843829 TGGGTACTCACCTGGGAGGAGGG - Intronic
1169612481 20:7397581-7397603 TGGGTACTCACATGGTGGGAGGG - Intergenic
1169836824 20:9889552-9889574 ATGGGAGGGACCTGGTTGGAAGG - Intergenic
1170323741 20:15132403-15132425 TTGATAGCCAGTTGGTTGGATGG + Intronic
1175987060 20:62769508-62769530 CTGCTAGTCACCTGGTTAGTTGG - Intergenic
1178593465 21:33931708-33931730 TTTGGAGGCACCTGGTTGCAGGG + Intergenic
1178922367 21:36747245-36747267 TTGGTGGCTACCTGATTGGACGG - Intronic
1182867066 22:33613101-33613123 TTGGTTGTCACCTGGGCTGAGGG - Intronic
1185169088 22:49281910-49281932 TTTGTAGACACCTGGAGGGAGGG + Intergenic
949111484 3:266376-266398 TTGGAAGCAACCTGGTTAGAAGG + Intronic
949336331 3:2979175-2979197 GAGGCAGTCACCTGGTAGGAGGG + Intronic
956318860 3:67972477-67972499 ATGGTGGTCACCAGGTTGGAGGG + Intergenic
960333675 3:116391915-116391937 TTGGCAGTCACCCTGATGGAGGG - Intronic
961632958 3:128314750-128314772 TTGGTCGTCACATGGTGGGTGGG - Intronic
962559017 3:136586891-136586913 TTTGCATTCACTTGGTTGGAAGG - Intronic
964561974 3:158007190-158007212 TTGTGAGGGACCTGGTTGGAAGG + Intergenic
965417674 3:168417250-168417272 TTGGTAGTCACAGTGTGGGAGGG + Intergenic
966985641 3:185177951-185177973 TTTGAAGTCACCTTGTTAGAAGG - Intergenic
970626096 4:17884742-17884764 TGTGTAGTCTCCTGGATGGATGG + Exonic
971273992 4:25178092-25178114 TTGGTGGGCACCTGTTAGGAAGG + Intronic
973976746 4:56270498-56270520 CTGATAGTCAGCTGGGTGGAAGG + Intronic
977174134 4:93798462-93798484 TTGGCACAAACCTGGTTGGAGGG + Intergenic
981569953 4:146141487-146141509 TTGGTAGCTACCCTGTTGGAAGG + Intergenic
997143258 5:131405847-131405869 CTGGCTGTCACCTGGCTGGAGGG - Intergenic
1002943389 6:1737257-1737279 TTGGTTCTCACCTGGTTGTAGGG + Intronic
1004326941 6:14683681-14683703 TTAGTACTCACCTGGTGTGATGG - Intergenic
1006845618 6:37059511-37059533 TTGTTGCTCTCCTGGTTGGAAGG - Intergenic
1013286932 6:108689776-108689798 CAGGTTGACACCTGGTTGGAGGG + Intergenic
1016815608 6:148300260-148300282 TTGGTAAACTCCAGGTTGGAAGG + Intronic
1019774814 7:2906249-2906271 CTGGTAGTCACCTGGCTGTCCGG + Exonic
1019908021 7:4079477-4079499 TTGGAAATGACCAGGTTGGATGG - Exonic
1024285127 7:47750547-47750569 TTGCTTGTCACCAGGGTGGACGG + Intronic
1029051367 7:97692318-97692340 AAGGTAGGCACCTGGTGGGAAGG + Intergenic
1032010414 7:128343387-128343409 TTGAGAGTCACCTGATTGGCAGG - Intronic
1033218435 7:139511253-139511275 TTGGTAAACACCTGGTTTGAGGG - Intergenic
1041798044 8:61767660-61767682 CTGAGAGTCACCTGGTGGGAAGG + Intergenic
1057181486 9:93033134-93033156 CTCCTGGTCACCTGGTTGGAGGG + Intronic
1057545100 9:96013636-96013658 TTGGTATACACCTGATTTGAGGG - Intronic
1059307123 9:113362650-113362672 AAGGTAGTCACCCTGTTGGAGGG + Intronic
1060250118 9:121979540-121979562 TTAGTGGCCACCTGGTTGTAAGG - Intronic
1186741525 X:12523227-12523249 TTTGTTGTTACCTGGTTGGCAGG - Intronic
1194712126 X:97248720-97248742 TTGGCAGTCACCTTGTTTCAAGG + Intronic
1194722577 X:97357470-97357492 TTGGTAGGCAACTGGAAGGAGGG - Intronic
1194775755 X:97962049-97962071 TTAGTAGTCACCTAGATTGATGG - Intergenic
1197457750 X:126699083-126699105 TTGGTAGTCACACGGCTGGAAGG + Intergenic
1197819163 X:130528892-130528914 TTGGCAGTCACCTGGTTCTCTGG + Intergenic
1198079207 X:133223262-133223284 TTGGCATTCATCTGGTTGGCAGG - Intergenic
1202174132 Y:22081899-22081921 TTTGTAGGCCCCTGGTTTGAAGG + Intronic
1202217228 Y:22504483-22504505 TTTGTAGGCCCCTGGTTTGAAGG - Intronic
1202325958 Y:23691576-23691598 TTTGTAGGCCCCTGGTTTGAAGG + Intergenic
1202544813 Y:25978478-25978500 TTTGTAGGCCCCTGGTTTGAAGG - Intergenic