ID: 914250449

View in Genome Browser
Species Human (GRCh38)
Location 1:145917943-145917965
Sequence CTGGAGAAATGGTGAGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 420}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914250449_914250463 28 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250463 1:145917994-145918016 AAAAAGAGTCTAGAAAGGGGTGG 0: 1
1: 0
2: 3
3: 39
4: 390
914250449_914250461 24 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250461 1:145917990-145918012 GAGAAAAAAGAGTCTAGAAAGGG 0: 1
1: 1
2: 3
3: 97
4: 861
914250449_914250460 23 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250460 1:145917989-145918011 GGAGAAAAAAGAGTCTAGAAAGG 0: 1
1: 0
2: 7
3: 63
4: 574
914250449_914250464 29 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250464 1:145917995-145918017 AAAAGAGTCTAGAAAGGGGTGGG 0: 1
1: 0
2: 1
3: 25
4: 306
914250449_914250456 -5 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250456 1:145917961-145917983 TCCAGGCCAGAGGAAGGGAAAGG 0: 1
1: 0
2: 8
3: 101
4: 639
914250449_914250462 25 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250462 1:145917991-145918013 AGAAAAAAGAGTCTAGAAAGGGG 0: 1
1: 0
2: 1
3: 94
4: 886
914250449_914250455 -10 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250455 1:145917956-145917978 ATTTCTCCAGGCCAGAGGAAGGG 0: 1
1: 0
2: 2
3: 29
4: 254
914250449_914250465 30 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250465 1:145917996-145918018 AAAGAGTCTAGAAAGGGGTGGGG 0: 1
1: 0
2: 1
3: 27
4: 299
914250449_914250459 2 Left 914250449 1:145917943-145917965 CCCATATCTCACCATTTCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 420
Right 914250459 1:145917968-145917990 CAGAGGAAGGGAAAGGCATAAGG 0: 1
1: 0
2: 6
3: 88
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914250449 Original CRISPR CTGGAGAAATGGTGAGATAT GGG (reversed) Intronic
900468608 1:2839011-2839033 ATTTAGAAATGGTGCGATATAGG + Intergenic
901915398 1:12495594-12495616 ATGGAGAAATAGTCAGATTTGGG + Intronic
902109123 1:14063584-14063606 CTGAATAGATGGTGTGATATTGG - Intergenic
902266742 1:15272462-15272484 CTGGAGACATCCTGAGATTTGGG + Exonic
902340670 1:15781626-15781648 AAGTAGAAATGGTGAGATGTGGG - Intronic
904255535 1:29252175-29252197 CTCCTGAAATGGTGAGATGTGGG - Intronic
904580196 1:31537504-31537526 TAGGGGAAATGGGGAGATATTGG + Intergenic
906086706 1:43141968-43141990 GAGGAGAAATGGGGAGAGATTGG + Intergenic
908562357 1:65319382-65319404 CTGGAGGAAGAGTGAGATAATGG + Intronic
909303968 1:74048376-74048398 CTGGACAAATGGTCACATTTTGG - Intronic
909768221 1:79385556-79385578 ATGGTGAAATGGTGATATTTTGG + Intergenic
910082924 1:83363403-83363425 TAGGAGAAATGGTAAAATATTGG + Intergenic
910268349 1:85365380-85365402 CTGGAGAAATGGAAGGATAGAGG + Intronic
910406407 1:86895925-86895947 CTAAAGAAATAGTGGGATATAGG + Intronic
912148812 1:106830629-106830651 TGGGAGAAATGGGGAGATATTGG + Intergenic
912281490 1:108319712-108319734 AGGGAGAAATGGGGAGATGTTGG - Intergenic
913345080 1:117800838-117800860 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
914250449 1:145917943-145917965 CTGGAGAAATGGTGAGATATGGG - Intronic
914736387 1:150421369-150421391 CTGGATAAATGAAGATATATAGG + Intronic
914953713 1:152143318-152143340 GTGGAGAAATAGAGAGATATTGG - Intergenic
915032938 1:152899749-152899771 CTGGGGAAATGGGGAGATGTTGG - Intergenic
915300449 1:154948402-154948424 CTGGAGAGATGGGGAGACACAGG + Intronic
915694783 1:157728854-157728876 CTGGAGAGATGTGGAGAAATAGG + Intergenic
915969030 1:160339475-160339497 CTGGAGAAATGGTGAGAGAAGGG - Intronic
916247167 1:162700146-162700168 AAGAAGAAATGGTGAGAGATAGG - Intronic
916303287 1:163300199-163300221 TTGGAGAAAAGATGAGATAGAGG + Intronic
919010631 1:191957568-191957590 CTGGAGAAAAATTGAAATATTGG - Intergenic
920656804 1:207882761-207882783 GAGGAGAAAAGGAGAGATATGGG - Intergenic
920724862 1:208425273-208425295 CTGCAGAAAGGGTGAGTAATAGG - Intergenic
920781842 1:209000744-209000766 TTGTAGAAACTGTGAGATATAGG - Intergenic
921436024 1:215123094-215123116 CTGGGGAAATGTTCAGAAATAGG + Intronic
921807688 1:219474791-219474813 CTGGAGAAAGGGAGAGATCACGG - Intergenic
922084101 1:222329044-222329066 TGGGAGAAATGGGGAGATGTAGG + Intergenic
923720103 1:236459661-236459683 CTGGAGCAATGGTGCCATCTCGG + Intronic
923922146 1:238578985-238579007 CAGAAGAAAGGGTAAGATATTGG - Intergenic
924320632 1:242845138-242845160 TGGGAGAAATGGGGAGATAATGG - Intergenic
1062937992 10:1402077-1402099 CTGGAGAAGTGCTGACATCTGGG + Intronic
1062978980 10:1706311-1706333 CATGAAAAATGGTGAGAAATGGG + Intronic
1063311105 10:4952800-4952822 CTGGAGAAATGCAGAGATGCAGG + Intronic
1063316693 10:5013595-5013617 CTGGAGAAATGCAGAGATGCAGG - Intronic
1063337278 10:5228183-5228205 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1063655772 10:7986958-7986980 CTGGGGGAAGGGTGAGATGTGGG - Intronic
1065071627 10:22030989-22031011 GTGGAGAAATGGTCAGATTCTGG - Intergenic
1067805718 10:49391613-49391635 CTGGAGTAGGGGTGAGATAAAGG - Intronic
1068564839 10:58563127-58563149 CTGTAGGCATGGTGAGATAGTGG + Intronic
1068815714 10:61309378-61309400 TAGGGGAAATGGTGAGATGTTGG - Intergenic
1068843033 10:61637587-61637609 GTGGAGAATTGGGGAGACATTGG - Intergenic
1069442013 10:68437597-68437619 GTTGAGCAATGGTGAGATCTTGG - Intronic
1069537788 10:69267895-69267917 CTGGAGAAATGGTCAGGGACAGG - Intergenic
1070242778 10:74699624-74699646 CTGGAGTACTGGTGTGATCTTGG - Intronic
1070957250 10:80472337-80472359 CTGCGGAAATGGTGAGTTCTAGG + Intronic
1071674874 10:87646257-87646279 CTGGAGAAATGATAAGACAAAGG + Intergenic
1072021119 10:91402787-91402809 CAGGAAAAATGGGGAGATGTTGG + Intergenic
1072361023 10:94659346-94659368 CTGGAGAGAATGTGAGAAATAGG - Intergenic
1075592342 10:123702090-123702112 CTGGAGCAATGGCGTGATCTTGG + Intergenic
1076084185 10:127610726-127610748 CTGGGGAGATGGTCAGGTATGGG + Intergenic
1076718861 10:132383915-132383937 CTGGAGACAGGGTGAAATCTCGG - Intergenic
1078356318 11:10634534-10634556 TGGGAGAAATGGGGAGATGTTGG - Intronic
1078395851 11:10981319-10981341 TTGGAGAAATGGTAAGCAATTGG - Intergenic
1078481893 11:11684293-11684315 CTGGAGGATTAGGGAGATATTGG + Intergenic
1078999258 11:16737716-16737738 CTGGAGAGAGGGCGAGAAATGGG + Intronic
1079356742 11:19736136-19736158 CTATAGAGAGGGTGAGATATAGG - Intronic
1079548056 11:21659154-21659176 GTGGGGAAATGGAGAGATGTTGG + Intergenic
1080045919 11:27808050-27808072 CTGGAGTAGTGGTGCGATCTTGG + Intergenic
1083631890 11:64099853-64099875 ATAGAGAAATGGTGAGATGGAGG + Intronic
1085128833 11:74020293-74020315 CTAGAGACATGGTCAGAAATGGG - Intronic
1086418268 11:86611242-86611264 GTGGGGAAATGGGGAGATGTTGG + Intronic
1087259768 11:95998089-95998111 GTGGATAAATGGGTAGATATAGG - Intronic
1088891114 11:114044933-114044955 ATGGAGAGATGGTGTGATGTGGG - Intergenic
1090288534 11:125521390-125521412 CAGGACAAATGGTGTGATGTTGG - Intergenic
1090761850 11:129844298-129844320 TGGGGGAAATGGGGAGATATTGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092312789 12:7376054-7376076 CTGGAGACAGGGATAGATATTGG - Intronic
1092334310 12:7615240-7615262 TTGGGGAAATGGAGAGATATTGG + Intergenic
1092620770 12:10264838-10264860 TAGAAGAAATGGAGAGATATCGG - Intergenic
1092866273 12:12764348-12764370 AGGGAGAATTGGGGAGATATTGG - Intronic
1093244876 12:16723912-16723934 CTGATGAAGAGGTGAGATATGGG + Intergenic
1093454681 12:19353508-19353530 CTGGTGCAATGGTGCGATCTCGG + Intronic
1093557667 12:20496089-20496111 TGTGAGAAATGGTGAGAAATGGG + Intronic
1095192597 12:39274662-39274684 CTGCAGAAATGGGTAGAAATGGG - Intergenic
1096791728 12:54049129-54049151 CTGGAGAAATTGTTAGTTAGAGG - Intronic
1096884926 12:54708277-54708299 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1097108073 12:56636767-56636789 TTGGGGAAATGCTGAGTTATGGG - Intronic
1098698510 12:73591216-73591238 GTGGAGGAAGGGTAAGATATGGG - Intergenic
1098786734 12:74767830-74767852 TGGGAGAAATGGGGAGATGTTGG + Intergenic
1098883170 12:75937189-75937211 CTGGAGGAATGGAAAGCTATTGG + Intergenic
1098925694 12:76347979-76348001 CTTGAGAATTGGTAAGATTTGGG + Intronic
1099183569 12:79494186-79494208 CTGGAGAGATGTGGAGAAATAGG - Intergenic
1101225785 12:102686959-102686981 CTGGTGACATCCTGAGATATTGG - Intergenic
1101766580 12:107706031-107706053 CTGGAGAGATGTGGAGAAATAGG - Intronic
1104468784 12:129011669-129011691 CTGGGGAAACGGGGAGATGTGGG - Intergenic
1104959135 12:132479920-132479942 CTGGAGAAATGGGGAGGAAAGGG + Intergenic
1106000216 13:25715493-25715515 CTGGGGAACTGGAGAGACATTGG - Intronic
1106782386 13:33072083-33072105 CTGGAGACATCGTGAGACCTAGG + Intergenic
1107115456 13:36741493-36741515 CTGGAGAAAAAGTGACATTTGGG - Intergenic
1107818863 13:44268203-44268225 CTTTGGAAATGCTGAGATATAGG - Intergenic
1108305124 13:49123853-49123875 CTGGAGAGATGTGGAGAAATAGG + Intronic
1109486053 13:63021500-63021522 TTGGGGAAATAGTGAGATACTGG - Intergenic
1109583702 13:64371819-64371841 CTGGAGCAATTGTGAGACTTTGG - Intergenic
1109757520 13:66779954-66779976 ATGGAGAAATAGGGTGATATAGG + Intronic
1110484798 13:76026231-76026253 GAGGGGAAATGGGGAGATATTGG - Intergenic
1110512603 13:76368977-76368999 AGGGGGAAATGGTGAGATGTTGG + Intergenic
1110553737 13:76835234-76835256 GTGGGGAAATGGGGAGATGTAGG + Intergenic
1110812832 13:79829400-79829422 CTGAAGTAATGGTGCCATATTGG - Intergenic
1111069969 13:83152778-83152800 CTGGAAACATGGTGATACATTGG - Intergenic
1111336312 13:86828818-86828840 CAGGAGAAATGTGGAGATGTTGG - Intergenic
1111980273 13:95008214-95008236 GTTGAGAAATGTTGAGAAATGGG - Intergenic
1112126865 13:96477817-96477839 CTGAAGCAATGGTGCGATCTCGG - Intronic
1112924647 13:104659297-104659319 ATGGACAAATGGAGAGAAATTGG + Intergenic
1113935013 13:113989348-113989370 ATGGACAGATGGTGAGAGATGGG - Intronic
1114636027 14:24187388-24187410 CTGAAGATGTGGTGAGATGTGGG - Exonic
1115887076 14:37984327-37984349 GTGGGGAAATAGGGAGATATGGG + Intronic
1117852160 14:59985305-59985327 TAGGGGAAATGGGGAGATATTGG + Intronic
1118132177 14:62978930-62978952 CTGGAAAAATGCTGAGAAAGTGG - Intronic
1119073957 14:71616871-71616893 CTGGAGAAATTCCCAGATATAGG - Intronic
1119585415 14:75830021-75830043 TTAGAGAAATAGTGAGATATTGG + Intronic
1120250635 14:82058718-82058740 CCTGAGGAATGGTGACATATTGG + Intergenic
1121412422 14:93757169-93757191 ATGGAGAAATTGTGAGACGTGGG + Intronic
1121991133 14:98558692-98558714 CTAGAGAAATGGAGAGAACTTGG - Intergenic
1122734069 14:103825224-103825246 CTCGAGAAAGGGAGAGAAATGGG - Intronic
1123804465 15:23856981-23857003 CTGGGGAAATGGTGAGTTAAGGG + Intergenic
1124367442 15:29082485-29082507 TGGGGGAAATGGGGAGATATTGG - Intronic
1125397949 15:39270414-39270436 CTGGAGAGATGGGGAGGTCTGGG + Intergenic
1125457768 15:39878267-39878289 TGGGAGAAATGGGGAGATGTTGG - Intronic
1125695587 15:41634630-41634652 CAGGAGAAATGGTGATTTAGAGG + Intronic
1125783740 15:42296091-42296113 CTGGAGCAATGGTATGATCTCGG - Intronic
1126195463 15:45925796-45925818 GTGAAGAAATGGGGAGATGTAGG + Intergenic
1126487951 15:49203696-49203718 TTTTATAAATGGTGAGATATTGG + Intronic
1126569390 15:50133680-50133702 TTAGAGAAATGGGGAGATGTTGG + Intronic
1127822187 15:62668050-62668072 GTGGGGAAATGGGGAGATAGTGG + Intronic
1128026566 15:64442344-64442366 CTTAAGAAATGGTGAGATATTGG + Intronic
1129321593 15:74778004-74778026 CTGGGGAGATGGTGCGAGATGGG - Intergenic
1129536296 15:76315981-76316003 CTGGAGGAATGGTGCCATATTGG + Intergenic
1130312538 15:82767863-82767885 CTGGAGAAATGAAGAGGTGTTGG - Intronic
1130897474 15:88182503-88182525 GTGGAGAAGTGGTGTGCTATGGG - Intronic
1131757717 15:95583763-95583785 ATGGAGAAACAGTGAGATTTGGG + Intergenic
1133429899 16:5727616-5727638 GTGGGTAAATGGGGAGATATTGG - Intergenic
1133447878 16:5877773-5877795 ATGGAGAAATGTTTAGAAATAGG + Intergenic
1134503265 16:14785577-14785599 TGGGAGAAAGGGTGTGATATTGG + Intronic
1134577302 16:15343321-15343343 TGGGAGAAAGGGTGTGATATTGG - Intergenic
1134725142 16:16413172-16413194 TGGGAGAAAGGGTGTGATATTGG + Intergenic
1134899197 16:17920069-17920091 TTGGAGTACTGGGGAGATATTGG - Intergenic
1134942288 16:18298686-18298708 TGGGAGAAAGGGTGTGATATTGG - Intergenic
1136045285 16:27610278-27610300 AGGGAGAAATGGTCAGATTTTGG + Intronic
1136575896 16:31124976-31124998 CTGGAGCAATGGTGCAATCTTGG - Intronic
1138034656 16:53592244-53592266 TTGTAGAAATTGTGAGACATTGG + Intergenic
1138831103 16:60375390-60375412 CGGGAAAACTGGTGAGAAATCGG + Intergenic
1139051092 16:63125324-63125346 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1139143943 16:64301929-64301951 ATGGATAAATGGAGAGATTTTGG + Intergenic
1139584777 16:67894972-67894994 CTGGAGCAATGGCGCGATCTTGG + Intronic
1141535428 16:84676552-84676574 CTCGAGGAATGGTGCCATATGGG - Intergenic
1142027879 16:87824177-87824199 CTGCAGAGATGGTGAGATGGTGG - Intergenic
1142164147 16:88576666-88576688 CCAGAAAAATGGTGAGATCTGGG + Intronic
1142470542 17:161101-161123 CTGGGGAGATGGGGAGAGATGGG - Intronic
1142929591 17:3271371-3271393 CTGGTGTGATGGTGAGATGTGGG - Intergenic
1143357907 17:6344342-6344364 TTGGATAGATGGTTAGATATGGG - Intergenic
1145374586 17:22335631-22335653 GTGGGGAAATGGAGGGATATGGG + Intergenic
1146636178 17:34507015-34507037 CCAGAGAAATAGTGAGAGATCGG + Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149259744 17:54865758-54865780 CTGGAGAAATGATGAGTAACAGG + Intergenic
1149894683 17:60420614-60420636 CTGGAGCAATGGCGTGATCTCGG - Intronic
1151023008 17:70641170-70641192 CTGAAGAAATAGTGAGATGGGGG - Intergenic
1151239387 17:72745918-72745940 GTGGAGAAATGACGAGTTATGGG + Intronic
1153168876 18:2292853-2292875 CTGGTGAACTGGTGTGATTTAGG + Intergenic
1155794103 18:30011785-30011807 GAGGATAAATGGAGAGATATTGG - Intergenic
1156050290 18:32924528-32924550 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1156110632 18:33722109-33722131 CTGAAGAAAGGGAGAGAAATGGG - Intronic
1156298222 18:35811852-35811874 ATGGAAGAATGGTGAGAAATGGG + Intergenic
1156849200 18:41706400-41706422 TGGGAAAAATGGGGAGATATTGG - Intergenic
1158568542 18:58576321-58576343 CTGGAGCAATGGTACGATCTCGG - Intronic
1158674659 18:59507291-59507313 TTGTAGAAATGGAGAGACATAGG - Intronic
1159214390 18:65371880-65371902 CTGGTGCAATGGTGCGATCTCGG + Intergenic
1159591203 18:70337133-70337155 GTGGAGAGATGGAGAGATAAAGG + Intronic
1159763080 18:72452953-72452975 GAGGGGAAATGGTGAGATGTTGG + Intergenic
1162233676 19:9287841-9287863 GTGGAGAAATGGGAAGATGTTGG + Intergenic
1163183814 19:15622431-15622453 CTGGAGAGATGATGAGAACTAGG + Intronic
1164307745 19:24019737-24019759 CTGGAGGAATGGGGAGAAAGGGG + Intergenic
1165073090 19:33266975-33266997 CTGGAGAAAGGGTGAGGCCTGGG - Intergenic
1165611589 19:37158469-37158491 CTGGAGACTTGATGAGATAGGGG - Intronic
1165817677 19:38652377-38652399 CTGAAGAAAAGGTGGGGTATGGG + Intronic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
1167366658 19:49058134-49058156 CAGGAGAAAAGGTAAGATTTGGG - Exonic
1167887555 19:52514603-52514625 CTGGAAAAATGTTGAAACATGGG + Intergenic
1167892919 19:52556899-52556921 CTGGAAAAATGTTGAAACATGGG + Intronic
1167904229 19:52645069-52645091 CTGGACAAATGTTGAAAGATGGG - Intronic
1167911157 19:52702688-52702710 CTGGAAAAATGTTGAAACATGGG - Intergenic
1167918759 19:52763632-52763654 CTGGAAAAATGTTGAAACATGGG - Intergenic
1168329758 19:55560812-55560834 CCAGAGAAATGATGAGAAATGGG - Intergenic
925002068 2:411226-411248 GTGGAAAAATGATGAGATGTTGG - Intergenic
926565405 2:14464122-14464144 TGGGAGAAATGGAGAGCTATTGG + Intergenic
927334272 2:21903954-21903976 CTGGAGAGATGTGGAGAAATAGG - Intergenic
929068429 2:38004613-38004635 TGGGAGAAATGGGGAGATATTGG - Intronic
929223925 2:39493740-39493762 ATAGAGGAATGGGGAGATATTGG - Intergenic
930446612 2:51481606-51481628 CTGGAGAAATGGGGAAATGTTGG + Intergenic
931276524 2:60748401-60748423 ATGGAGAAATGATGAGATAAAGG + Intergenic
932131856 2:69194800-69194822 CTGGAGCAGTGGTGCGATCTCGG - Intronic
933444369 2:82359785-82359807 TGGGAGAAATGGGGATATATTGG - Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
935441759 2:103106179-103106201 CTGGAGAAATGGCTAATTATAGG - Intergenic
935724794 2:106014188-106014210 GAGGGGAAATGGGGAGATATTGG - Intergenic
936229040 2:110683299-110683321 CTGGAGACAGGGAGAGAGATGGG + Intergenic
936621715 2:114106614-114106636 TTATATAAATGGTGAGATATGGG + Intergenic
937393684 2:121515847-121515869 CTGGTAAAATGGTGATAAATTGG - Intronic
937484196 2:122296997-122297019 GTAGAGAAATTGTCAGATATAGG + Intergenic
938939557 2:136157748-136157770 TTGGGGAAATGGTGAAATTTGGG + Intergenic
939541195 2:143496249-143496271 ATGGAGAAATGTTGAGAAAAGGG + Intronic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
940472962 2:154122478-154122500 CTGGAAAAATTGTGAGGAATTGG + Intronic
940959934 2:159773976-159773998 CTGAAGAAATGTTGAGAAAATGG - Intronic
941118411 2:161498952-161498974 TGGGAGAAATGGGGAGATGTTGG - Intronic
941126280 2:161587776-161587798 CTGGGGAAATGGGGAGATGGTGG - Intronic
941139360 2:161759466-161759488 ATGCAGAAATGGGGAGATATTGG - Intronic
941839834 2:170069577-170069599 TGGGAGAAATGGGGAGATGTTGG - Intronic
942117971 2:172747807-172747829 AAGGGGAAATGGGGAGATATTGG - Intronic
942677232 2:178440658-178440680 CTGGGAAAATGGAGAGAGATGGG - Intronic
942763144 2:179424043-179424065 CTTGAGAAATGGAGAGAATTAGG - Intergenic
942893433 2:181019984-181020006 ATGGGGAAATGGGGAGATATTGG - Intronic
943091461 2:183380431-183380453 CTAGAGAAATAGTAAGATGTTGG - Intergenic
943571209 2:189577438-189577460 CTGGAGAAATGCAGACATATTGG + Intronic
943763032 2:191630515-191630537 CTGCAGAAAGGGTTAGATAAGGG - Intergenic
943805245 2:192116329-192116351 CTGAGGAAATGGGGAGATGTTGG + Intronic
944150822 2:196556434-196556456 CGGGAGAAAATGGGAGATATTGG - Intronic
944517337 2:200525826-200525848 CAGAAGAAATGGTAAGATGTGGG + Intronic
945945715 2:215993920-215993942 CTGGAGAGATGTGGAGAAATAGG + Intronic
947085645 2:226448907-226448929 CTGCAGAAATGATGAAAGATTGG - Intergenic
947292632 2:228594053-228594075 CTGGAGAGAAGTTGAGATAGGGG + Intergenic
948000627 2:234563889-234563911 CTGGAGCAGTGGTGCGATCTCGG - Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
1169278907 20:4250736-4250758 CTGCAGAAATGTTTAGAGATGGG + Intergenic
1170180836 20:13528170-13528192 CTGGAGCAGTGGTGCGATCTTGG - Intronic
1170851365 20:20007514-20007536 TTGTAGAAGTGGTGAGAAATCGG - Intergenic
1173925233 20:46776368-46776390 CTGGAGAAATACTGAGAGATGGG + Intergenic
1174180648 20:48672336-48672358 CAGGAGAAATGGTCAGATTCTGG - Intronic
1176414163 21:6465596-6465618 CTGGAGCAGTGGTGCGATCTCGG + Intergenic
1177093846 21:16806497-16806519 CTAGTGAAATGGTGCCATATTGG - Intergenic
1178021125 21:28409549-28409571 GTAGAGAAATGAGGAGATATTGG - Intergenic
1178507611 21:33175581-33175603 CGGGGGAAATGGGGAGATGTTGG + Intergenic
1178604829 21:34026981-34027003 TGGGAGAAATGGAGAAATATTGG - Intergenic
1179115043 21:38483132-38483154 ATGGGGAAATGGGGAGATGTAGG + Intronic
1179689661 21:43073918-43073940 CTGGAGCAGTGGTGCGATCTCGG + Intronic
1180589900 22:16928464-16928486 GTGGGGAAATGGTGAGATTTGGG + Intergenic
1180610327 22:17092261-17092283 CAGAAGAAAAGGTGAGGTATAGG - Intronic
1183233842 22:36601127-36601149 GGGAAGAAATGGAGAGATATAGG - Intronic
1184926939 22:47649030-47649052 TTGGAGAAATGGTTAGTTCTGGG + Intergenic
1185097916 22:48821811-48821833 CTGCAGATATGGTGGGATGTGGG + Intronic
949396763 3:3622751-3622773 TTGGACAAAAGGTGAAATATAGG + Intergenic
949429083 3:3953607-3953629 GAGGAGAAATGGGGAGATGTAGG - Intronic
949893339 3:8749552-8749574 CTGGAGCACTGGTGAGCTCTGGG - Intronic
950986676 3:17378220-17378242 CTGGAGAAATCCTCAGAAATAGG - Intronic
951855624 3:27193685-27193707 CTGGAAAAATAGTGGGATTTTGG - Intronic
952214045 3:31258298-31258320 TTGGAGAAATGGAGAGATGTTGG - Intergenic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952439762 3:33314308-33314330 CAGGGGAAATGGGGAGATGTTGG - Intronic
953343426 3:42155164-42155186 ATGGAGAAAAGGTGAGACAAAGG + Intronic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953744694 3:45565359-45565381 CATGTGAAATGGTGAGATACTGG + Intronic
954133836 3:48573009-48573031 CTGGACAAGTGGTGAGTTCTGGG - Exonic
954576910 3:51681368-51681390 CTGGAGTGATGGAGAGAGATGGG + Intronic
955023318 3:55142547-55142569 CATGCTAAATGGTGAGATATTGG + Intergenic
955613506 3:60782000-60782022 TAGGGGAAATGGGGAGATATTGG - Intronic
955939816 3:64137093-64137115 CTGGTCAAGTGGTGAGATTTGGG + Intronic
955998337 3:64701097-64701119 ATTGAGAAGTGGAGAGATATTGG + Intergenic
956200085 3:66696775-66696797 GAGGAGAAATGATGAGAGATGGG - Intergenic
956342322 3:68239473-68239495 CTGGATAAAGGGTGAAATATTGG - Intronic
956350811 3:68334001-68334023 TGGGAGAAATGGGGAGATCTTGG + Intronic
956771796 3:72532862-72532884 GTAGGGAAATGGTGAGAAATTGG + Intergenic
957021370 3:75131736-75131758 TAGGGGAAATGGGGAGATATTGG + Intergenic
960659948 3:120046394-120046416 CAGGGGAAATGGGGAAATATGGG + Intronic
962338872 3:134564017-134564039 CTAGAGAAATGGGGAGAAACAGG - Exonic
962366468 3:134788509-134788531 GGGGAGAAAAGGAGAGATATAGG + Intronic
963537435 3:146545386-146545408 CAGGAGAAATGGGGAAATTTAGG - Intergenic
963611829 3:147478037-147478059 CTGGAGCAATGGTGTGATCTTGG - Intronic
963801085 3:149676965-149676987 CTGGAGCAATGGGGCGATCTTGG + Intronic
964200703 3:154115723-154115745 CTGGATTAATGGTGATATTTAGG - Intergenic
965826857 3:172739846-172739868 CTGGAGATATGGAGATACATTGG + Intergenic
966306988 3:178547435-178547457 CTGGATAGATGGTGAGATTATGG + Intronic
966962941 3:184958710-184958732 TTGGAGAGTTGGTCAGATATTGG + Intronic
968475549 4:805059-805081 CTGGAGACAAGGTGATATCTTGG + Intronic
969331846 4:6478149-6478171 ATGGAGAAAAGGTGAGACGTAGG - Intronic
969996895 4:11322639-11322661 TGGGAGAAATGGAGAGATATTGG + Intergenic
970333740 4:15010006-15010028 CTGGTAAACTGCTGAGATATTGG + Intronic
972371717 4:38430512-38430534 CTGAAGAAATGGTGCCAAATTGG + Intergenic
972618033 4:40719006-40719028 CTACTGAAATGGTGAGACATTGG - Intergenic
972664744 4:41154149-41154171 CTGGAGAACTGGGGAGAAATTGG - Intronic
974776433 4:66488877-66488899 TAGGAGAAATGGGGAGATTTTGG + Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975545533 4:75556846-75556868 CTGAAGAAAAGGTTAGATCTAGG - Intronic
975647271 4:76557464-76557486 CAGGGGAAATGGGGAGATGTTGG + Intronic
975850154 4:78563791-78563813 CTGGATATATGGAGAAATATAGG - Intronic
976038193 4:80849728-80849750 AGGGAGAAATGGTGAGAGGTTGG + Intronic
976076718 4:81307328-81307350 AGGGAGAAATGGGGAGATGTTGG + Intergenic
976274044 4:83258129-83258151 TGGGAGAAATGGGGAGGTATGGG + Intergenic
976493281 4:85696840-85696862 ATGCAGAAATGGTGAGATAAAGG + Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976953077 4:90857736-90857758 CAGGAGAAATGGGGAAATGTAGG + Intronic
977507592 4:97922025-97922047 GTGAAGAAATGGAGAGATTTAGG + Intronic
977905304 4:102470764-102470786 CTGGAGAAATTGTGTAAAATTGG - Intergenic
978041366 4:104067298-104067320 GTGGGGAAATGGCAAGATATTGG + Intergenic
978827988 4:113047736-113047758 CTGAAGCAATGGTGAGAGAATGG + Intronic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979992553 4:127392254-127392276 GCGGAGAAATGGTGAGAAAAGGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980088635 4:128418081-128418103 GTGGAGAAAAGGTGACATGTGGG - Intergenic
980401393 4:132290599-132290621 CTGGAGAAATGGTGGGATGGGGG + Intergenic
981485651 4:145283290-145283312 CTGTAGAAATGAAGAAATATTGG - Intergenic
981959845 4:150523367-150523389 ATGGAGAAAGGGTAAGATAGTGG - Intronic
982036621 4:151352504-151352526 CTGGAGTAGTGGTGAGATCTTGG - Intergenic
982567918 4:157009770-157009792 CTTGAGAAACGGTGCCATATTGG - Intergenic
983022092 4:162689968-162689990 TGGGAGAAATGGTGCAATATTGG + Intergenic
984537590 4:180996222-180996244 AAGGAGAAATGGAGAGATGTTGG - Intergenic
984631335 4:182064530-182064552 CTGGAGCAGTGGTGCGATCTCGG - Intergenic
985093004 4:186382532-186382554 CTGGTGAACTGGTGTGATTTTGG - Intergenic
985215541 4:187649711-187649733 CTGAAGAAATGATGCAATATTGG - Intergenic
985215946 4:187654203-187654225 CTGGTGAAATGGGGAGATTTAGG + Intergenic
985268112 4:188168816-188168838 TTGGACAGATGGTGAGAAATGGG - Intergenic
986247626 5:6025136-6025158 GCGGAGAGATGGGGAGATATGGG + Intergenic
986450990 5:7865196-7865218 CTTTAGAAATGGTAAGAGATCGG + Intronic
986957558 5:13172527-13172549 AGGGAGAAATGGGGAGTTATTGG - Intergenic
987220170 5:15783189-15783211 GTGGAGAAATAGTGAGAAAGTGG + Intronic
987994690 5:25261592-25261614 CTTTAGAAATGGTGATATCTCGG + Intergenic
988131959 5:27118281-27118303 CTAAAGAAATGATGAGATATGGG + Intronic
988900565 5:35727974-35727996 TAGGAGAAAGGATGAGATATGGG - Intronic
989466284 5:41759256-41759278 CTGAAGTAAGGTTGAGATATGGG - Intronic
989531355 5:42511858-42511880 CTGGAAAAATACTGTGATATGGG + Intronic
989585098 5:43068285-43068307 CTGAAGAAAGGGTAAGGTATAGG - Intronic
989613123 5:43313823-43313845 CTGGAGAGATGGTCAAATGTGGG + Intergenic
991170503 5:63619566-63619588 CTGGAGAAATGGCACGATCTTGG + Intergenic
991322733 5:65393437-65393459 TTGGAGAAATGATGAGAGCTAGG - Intronic
991428341 5:66515677-66515699 CTGAAGAAAGGGGGAGAGATGGG + Intergenic
991462164 5:66870690-66870712 ATGGAGAAATGGTCAGAAAAGGG - Intronic
991476259 5:67023256-67023278 CTGGAGAGATAGTGAGATAAAGG + Intronic
991895122 5:71387788-71387810 TTGGGGAAATGGAGAGATGTTGG - Intergenic
993695755 5:91059750-91059772 CTGGAGAAAACTTGAGATAGAGG - Intronic
994096152 5:95850121-95850143 CTGGAGAAATGGCGCAATCTTGG + Intergenic
994145396 5:96389103-96389125 GGGGGGAAATGGGGAGATATAGG + Intergenic
994329830 5:98491734-98491756 CTGCAGAAATAGTGCTATATGGG - Intergenic
994431295 5:99664856-99664878 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
994435208 5:99720840-99720862 GAGAAGAAATGGGGAGATATAGG - Intergenic
994870290 5:105339410-105339432 CTGAAAAAAGGGGGAGATATGGG + Intergenic
995661126 5:114484492-114484514 CAGGAAAAATGGGGAGAAATAGG - Intronic
995819615 5:116214954-116214976 CTGGAGATGAGTTGAGATATTGG + Intronic
996290148 5:121843097-121843119 AGGGAGAAATGGGGAGATGTAGG + Intergenic
997285360 5:132674193-132674215 CTGGAGAGATGGTGCCAGATAGG - Intronic
997564687 5:134877821-134877843 CTGGAGCAATGGTGCGATCTTGG + Intronic
998479735 5:142452842-142452864 ATGGAGGAATGGTGAGAAACTGG - Intergenic
998566782 5:143223002-143223024 CTTTAGAGATGGTGAGAGATTGG - Exonic
999483280 5:151968575-151968597 AGGGAGAAATGGGGAGATGTTGG - Intergenic
1000104587 5:158047229-158047251 CTGGAGCAGTGGTGCGATCTTGG + Intergenic
1000105792 5:158057662-158057684 CTTGAGAACTCGTGAGATGTTGG - Intergenic
1000913750 5:167054241-167054263 CTGAAGAAATGGTGAAATTGTGG - Intergenic
1001499875 5:172222615-172222637 CTGTAGAAATGGTGTGTTCTGGG + Intronic
1002879228 6:1237104-1237126 ATGGAGAAATGGGGAGAGGTTGG - Intergenic
1003651356 6:7963406-7963428 GTGGGGAAATGGGGAGATGTTGG + Intronic
1005907293 6:30274577-30274599 TGGGAGAAATGGGGAGATGTTGG + Intergenic
1007060052 6:38930894-38930916 TGGGAGAAATGGGGAGATGTTGG - Intronic
1007670496 6:43549110-43549132 CTGGAGCAATGGCGTGATCTTGG + Intronic
1007805293 6:44439840-44439862 ATGGAGAAATGGAGACACATAGG + Intronic
1009513087 6:64578000-64578022 CTTGAGAAATGGTCAGATTCTGG - Intronic
1010796759 6:80125661-80125683 CTGAAGAAAGGGAGAGATAAAGG + Intronic
1011132321 6:84064325-84064347 GGGGAGCAATGGTGAGAAATGGG - Intronic
1011307942 6:85949784-85949806 CTGCATAAATGGTGAGCTCTAGG + Intergenic
1012094155 6:94936541-94936563 ATTCAGAAATGGTGAGATAAAGG + Intergenic
1013688543 6:112613536-112613558 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1014887569 6:126800235-126800257 TAGGAGAAATGGGGAGATGTTGG + Intergenic
1015603165 6:134930093-134930115 CTGGAGAAGTGATGAGATTCAGG + Intronic
1015764936 6:136706413-136706435 CTGTAGTCATGGTGAGGTATAGG - Intronic
1016279725 6:142401729-142401751 GTGGAGAAATGGAGAGAATTTGG + Intronic
1016892989 6:149025166-149025188 CTGTCTAAATGGTGAGTTATTGG - Intronic
1017543306 6:155425270-155425292 CTGGAGAAATGGAGAAATTTGGG - Intronic
1018276144 6:162133546-162133568 ATGGAGAAAGGGAGAGAAATAGG + Intronic
1020160512 7:5767647-5767669 CTGAAGTAATGGTGCGATCTTGG + Intronic
1021869844 7:24993697-24993719 ATGGAGATATGGTGAGGTCTGGG + Intergenic
1024020883 7:45367749-45367771 TGGGAGAAATGGGGAGATATTGG - Intergenic
1025824061 7:64996645-64996667 CTGGATAATTGGGGAGATACAGG + Intronic
1026260470 7:68750865-68750887 TGGGAGAAATGGGGAGATGTCGG - Intergenic
1027299759 7:76819605-76819627 TAGGAGAAATGGTAAAATATTGG + Intergenic
1027601994 7:80250764-80250786 ATTGAGAAGTGGTGAGAAATAGG - Intergenic
1027916230 7:84325895-84325917 GTGGGGAAATGGGGAGATGTTGG - Intronic
1027970504 7:85074665-85074687 CTGGAGTAGTGGTGCGATCTTGG + Intronic
1028177782 7:87677524-87677546 TAGGAGAAAAGGGGAGATATTGG + Intronic
1029442674 7:100595763-100595785 CTGGAGAAGTGGACAGATCTGGG - Intronic
1030485186 7:110156576-110156598 CTGAAGAAAAGGGTAGATATTGG - Intergenic
1031026195 7:116682806-116682828 CTTAAGAAATGGTGAGAGTTTGG - Intronic
1031211933 7:118840352-118840374 CTGGGGCAATGGTGTGATATGGG - Intergenic
1031672778 7:124570734-124570756 CAGGAGAAATGGGGAGATGTTGG - Intergenic
1031809677 7:126350512-126350534 CTGGAAAAAAGGTGGTATATGGG + Intergenic
1031902439 7:127426440-127426462 CTGGAGCAGTGGTGCGATCTTGG + Intronic
1032529691 7:132609915-132609937 CTGGAGAAATGGGAAAAAATGGG - Intronic
1033029450 7:137811092-137811114 CTGGAGCAATGGTGTGCTATTGG + Intronic
1033669379 7:143476602-143476624 AAGGGGAAATGGGGAGATATTGG + Intergenic
1033922081 7:146406553-146406575 ATGCAGAAAAGCTGAGATATTGG + Intronic
1034256867 7:149729465-149729487 CTGGGGAAAGGATGAGAGATGGG - Intronic
1035706747 8:1681605-1681627 CTGCAGTGATGGTGAGATCTCGG - Intronic
1036227548 8:6972216-6972238 CTGGAGAGCTGGTGAGATTCGGG + Intergenic
1036230006 8:6991376-6991398 CTGGAGAGCTGGTGAGATTCGGG + Intergenic
1036232458 8:7010479-7010501 CTGGAGAGCTGGTGAGATTCGGG + Intronic
1037546599 8:19929963-19929985 CTGGAAATATGGTGGGATGTGGG - Intronic
1038006327 8:23433470-23433492 CTGTAAAAATGGTGAGTCATGGG - Intronic
1039698940 8:39943023-39943045 CTGCAAAATTGGTTAGATATTGG + Intronic
1040714887 8:50238999-50239021 CTGGAGAAGTTGTGAGAAAGGGG + Intronic
1040802976 8:51363869-51363891 CTGGAGAAATAGCCAGAGATAGG + Intronic
1040999002 8:53431121-53431143 ATAGAGATATGATGAGATATTGG - Intergenic
1041758666 8:61340336-61340358 CTGGAGGACTGGGGAGATGTTGG - Intronic
1042530269 8:69807752-69807774 CTGGAGCAGTGGTGCGATCTCGG + Intronic
1043346657 8:79305450-79305472 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1043665280 8:82802950-82802972 TGGGAGAAATGGGGAGATACTGG + Intergenic
1044130183 8:88512933-88512955 CTGGGGAAATGAGGAGATCTTGG + Intergenic
1044186178 8:89254339-89254361 CTGAGGAAATGGTGAGTTAAAGG - Intergenic
1046323526 8:112610018-112610040 TAGGGGAAATGGTGAGATGTCGG + Intronic
1046860892 8:119090236-119090258 CTGGAGAAATGGTGGGGTACGGG + Intronic
1047068037 8:121309225-121309247 TGGGAGAATTGGAGAGATATTGG - Intergenic
1047150619 8:122257743-122257765 AGAGAGAAATGGGGAGATATTGG - Intergenic
1047368259 8:124232668-124232690 GGTGAGAAATGGTGAGATCTCGG - Intergenic
1047634648 8:126747367-126747389 CAGGAGAAATGGGTAGATGTTGG + Intergenic
1047784669 8:128142211-128142233 CTGGAGAAAGGGAGACATAGGGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048148372 8:131867974-131867996 CTGGAGAAGGGGTGAGCTGTAGG - Intergenic
1048678037 8:136806886-136806908 TTGTAGAAAGGGTAAGATATAGG - Intergenic
1050034221 9:1418020-1418042 GTGGAGAAATAGTGAGTTTTGGG + Intergenic
1050254143 9:3776637-3776659 CTGGAGATATGGTGAGATGAAGG - Intergenic
1050351438 9:4743987-4744009 CTGGTGCAGTGGCGAGATATTGG + Intergenic
1050607335 9:7315244-7315266 CTCTAGAAATGTGGAGATATGGG + Intergenic
1050953045 9:11621449-11621471 CAGGAGAATTGGGGAGATGTTGG - Intergenic
1051065383 9:13095801-13095823 CTAGAGAAATATTTAGATATTGG + Intergenic
1051770418 9:20572215-20572237 GTGGAGGAATGGGGAGATGTTGG + Intronic
1052120221 9:24705612-24705634 CTGGAGAATTGGGGGGAAATGGG + Intergenic
1053491156 9:38504424-38504446 CTGAAGAAATGATGGGATTTAGG - Intergenic
1054738791 9:68783635-68783657 CTTGAGGAATGATTAGATATGGG - Exonic
1056173476 9:84011027-84011049 ATGGAGAAATGGGCAGTTATAGG + Intergenic
1057671469 9:97093623-97093645 CTGAAGAAATGATGGGATTTAGG - Intergenic
1058487416 9:105455996-105456018 TTAGAGAAATGCTGACATATGGG - Intronic
1058652698 9:107191360-107191382 CTGGAGAAATGGTAAAAAACAGG - Intergenic
1060164170 9:121395355-121395377 CTTGGGAAATGGTGCCATATTGG + Intergenic
1060704596 9:125786691-125786713 CTGGAGATAAAGTGAGAGATAGG + Intronic
1187148505 X:16659899-16659921 TGGGAGAAATGGGGAGATGTTGG - Intronic
1188721157 X:33525522-33525544 ATGGGGAAATGGGGAGATGTTGG + Intergenic
1189224941 X:39404853-39404875 TTGGGGAAATGGGGAGATGTTGG - Intergenic
1190474646 X:50814201-50814223 CTGGAGAAAGGGGGAGAGAGGGG + Intronic
1190556863 X:51644690-51644712 CTGGGGTAATGGGGAGTTATAGG - Intergenic
1193055096 X:77141561-77141583 CTGAAGACATGGTAAGCTATGGG + Intergenic
1193114331 X:77761792-77761814 TGGGAGAAATGGGGAGATATTGG - Intronic
1193288111 X:79737635-79737657 TGGGAGAAATGGTGATATATTGG - Intergenic
1193569029 X:83118724-83118746 CTGAGGAAAGGGAGAGATATGGG + Intergenic
1194178615 X:90685317-90685339 ATGAAGAAATGGGGAGATGTGGG - Intergenic
1194358036 X:92912425-92912447 AAGGGGAAATGGTGAGATGTTGG + Intergenic
1196370740 X:114977063-114977085 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1196669368 X:118349295-118349317 CTGGAGAGGTGGTGAGATCATGG + Intronic
1197105265 X:122706584-122706606 CCGGAGAAATGTGGAGAAATAGG + Intergenic
1198089053 X:133309657-133309679 CTGGAGAAACAGTGAATTATAGG + Intronic
1198139981 X:133792687-133792709 CTGGATAAATGGTGTCAAATTGG + Intronic
1198416704 X:136427641-136427663 TTGGAGAAATGGGGAGATGTTGG - Intergenic
1198992742 X:142534730-142534752 TAGGGGAAATGGGGAGATATTGG - Intergenic
1199185791 X:144913311-144913333 CTGATGAAATGGTAAGGTATAGG - Intergenic
1199460029 X:148074126-148074148 TTGGAGAAATGGGGAGATGTTGG + Intergenic
1199804956 X:151290145-151290167 CTGGAGGAATCAGGAGATATTGG - Intergenic
1199997820 X:153037558-153037580 ATGGAGAAATGGTGCCATATTGG - Intergenic
1200525279 Y:4267480-4267502 ATGAAGAAATGGGGAGATGTGGG - Intergenic
1200666217 Y:6028076-6028098 AAGGGGAAATGGTGAGATGTTGG + Intergenic
1200903743 Y:8460133-8460155 CCAGAGAGATGGTGACATATAGG + Intergenic
1201502684 Y:14662271-14662293 ATGGAGAAATAGAGATATATAGG - Intronic
1202254977 Y:22911668-22911690 CCAGAGAGATGGTGACATATAGG + Intergenic
1202407968 Y:24545417-24545439 CCAGAGAGATGGTGACATATAGG + Intergenic
1202462814 Y:25124664-25124686 CCAGAGAGATGGTGACATATAGG - Intergenic