ID: 914254480

View in Genome Browser
Species Human (GRCh38)
Location 1:145950225-145950247
Sequence CAATTGCAAGAGATTTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914254478_914254480 -8 Left 914254478 1:145950210-145950232 CCAAGATGGGATAGACAATTGCA No data
Right 914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG No data
914254477_914254480 3 Left 914254477 1:145950199-145950221 CCAAGAAGACACCAAGATGGGAT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG No data
914254474_914254480 19 Left 914254474 1:145950183-145950205 CCTTAGTTCAGATCTGCCAAGAA 0: 1
1: 0
2: 1
3: 8
4: 115
Right 914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914254480 Original CRISPR CAATTGCAAGAGATTTATCA GGG Intronic
No off target data available for this crispr