ID: 914281113

View in Genome Browser
Species Human (GRCh38)
Location 1:146173872-146173894
Sequence TTCAAACATACGCATGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914281108_914281113 -3 Left 914281108 1:146173852-146173874 CCACATTTCCATTGTTACTGTTC 0: 5
1: 0
2: 4
3: 22
4: 353
Right 914281113 1:146173872-146173894 TTCAAACATACGCATGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914281113 Original CRISPR TTCAAACATACGCATGGGGT TGG Intronic
No off target data available for this crispr