ID: 914284073

View in Genome Browser
Species Human (GRCh38)
Location 1:146206489-146206511
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 5, 1: 0, 2: 4, 3: 31, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914284073_914284079 26 Left 914284073 1:146206489-146206511 CCTCTTTCCTTCAAGCACAGCAG 0: 5
1: 0
2: 4
3: 31
4: 272
Right 914284079 1:146206538-146206560 TGCAGACTTTGGGGGATCCAAGG 0: 5
1: 0
2: 1
3: 10
4: 204
914284073_914284075 15 Left 914284073 1:146206489-146206511 CCTCTTTCCTTCAAGCACAGCAG 0: 5
1: 0
2: 4
3: 31
4: 272
Right 914284075 1:146206527-146206549 ACATCTTTATCTGCAGACTTTGG 0: 5
1: 0
2: 1
3: 11
4: 219
914284073_914284078 18 Left 914284073 1:146206489-146206511 CCTCTTTCCTTCAAGCACAGCAG 0: 5
1: 0
2: 4
3: 31
4: 272
Right 914284078 1:146206530-146206552 TCTTTATCTGCAGACTTTGGGGG No data
914284073_914284077 17 Left 914284073 1:146206489-146206511 CCTCTTTCCTTCAAGCACAGCAG 0: 5
1: 0
2: 4
3: 31
4: 272
Right 914284077 1:146206529-146206551 ATCTTTATCTGCAGACTTTGGGG 0: 5
1: 0
2: 1
3: 27
4: 237
914284073_914284076 16 Left 914284073 1:146206489-146206511 CCTCTTTCCTTCAAGCACAGCAG 0: 5
1: 0
2: 4
3: 31
4: 272
Right 914284076 1:146206528-146206550 CATCTTTATCTGCAGACTTTGGG 0: 5
1: 0
2: 1
3: 13
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914284073 Original CRISPR CTGCTGTGCTTGAAGGAAAG AGG (reversed) Intronic
900668878 1:3836693-3836715 CTGCAGTGAGTGAAGGAGAGAGG + Intronic
901134753 1:6985982-6986004 CTTCCGTGCCTGAAGGAAACAGG - Intronic
901935045 1:12620998-12621020 TTTCTGGGCTTGAAGGGAAGAGG + Intergenic
902294619 1:15458212-15458234 CTGCTCTGCTTTAAAGAAACGGG - Intronic
902488293 1:16762483-16762505 CTGCAGGGCTTTAAGGAGAGAGG - Intronic
902984545 1:20147779-20147801 ATTCTGTGATTGAAGGGAAGAGG + Intronic
903959011 1:27044910-27044932 CTCCAGTGCTGGAGGGAAAGGGG - Intergenic
904608647 1:31713317-31713339 CTGGTGTGTTCGAACGAAAGAGG + Intergenic
906928625 1:50146532-50146554 CTAGTATGCTTCAAGGAAAGTGG + Intronic
907509185 1:54945769-54945791 CTTCTGTGCAAGCAGGAAAGAGG + Intergenic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
910536783 1:88307189-88307211 CTGCTCTTCTTGAAGTCAAGAGG + Intergenic
912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG + Intergenic
912709935 1:111942982-111943004 ATGCTGTGCTGGAGGGAATGCGG + Intronic
912837867 1:113012171-113012193 CTGAAGTGCTTAATGGAAAGGGG + Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915443280 1:155960028-155960050 CTGCTGGGGTTGAAGGAGATGGG - Intronic
915713681 1:157924968-157924990 CTGCTGGGCATTAAGGCAAGTGG - Intergenic
915986776 1:160474034-160474056 CTGCTTTGTATGAAAGAAAGTGG + Intergenic
916507247 1:165439355-165439377 TTCCGGTGCTTGAAGGAAGGGGG - Intronic
916850125 1:168695128-168695150 CTGCTGTGGATAAAGAAAAGAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918917966 1:190669912-190669934 CTGAGGTGCTTGAAGGCAAAGGG - Intergenic
919796187 1:201322828-201322850 CTGCAGTGCATAGAGGAAAGGGG + Intronic
922679283 1:227578353-227578375 CTGGTGTCCCTGAAGGAAATGGG - Intronic
922698039 1:227741506-227741528 CTGCTGGGGTGGAATGAAAGTGG - Intronic
923363225 1:233233703-233233725 GTGCTGCACTTGAAGGAGAGAGG + Intronic
923532149 1:234820030-234820052 CTGCAGGGCTTTAAGGAGAGAGG + Intergenic
924373133 1:243376167-243376189 TTGCTGTTCTTGAAAGACAGAGG + Intronic
924531986 1:244901149-244901171 AGGCCTTGCTTGAAGGAAAGTGG - Intergenic
1068141429 10:53013077-53013099 CTGCAGCGCTTGAAGGAACATGG - Intergenic
1069613291 10:69789713-69789735 CTGTTCTGCTTAAAGGAAAGAGG - Intergenic
1069794278 10:71042333-71042355 CTAATGTCCTTGTAGGAAAGGGG + Intergenic
1072933695 10:99691496-99691518 CTGCTTTGCAGGAAGGACAGAGG - Exonic
1074743419 10:116506961-116506983 CAGCTGTGTTTGCAGCAAAGAGG + Intergenic
1075950462 10:126473140-126473162 CAGCTGTGGTTGTAGGAATGTGG - Intronic
1076874852 10:133210984-133211006 CTGCTGACCTGGGAGGAAAGCGG + Intronic
1077955942 11:7020184-7020206 GAGCTGTGCTTGAAGGAAGAGGG - Exonic
1080852568 11:36082691-36082713 CTGCTAAGCTGCAAGGAAAGAGG - Intronic
1081045462 11:38268675-38268697 CTTCTATGCCTGAAGAAAAGGGG - Intergenic
1081356613 11:42121593-42121615 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
1081667214 11:44923569-44923591 CCTCTGTGCTTAAGGGAAAGGGG - Intronic
1081833161 11:46131661-46131683 GTGCTGTGAGTGAAAGAAAGAGG + Intergenic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1085451357 11:76635992-76636014 CTGAGGTCCTTGGAGGAAAGAGG + Intergenic
1085564623 11:77501946-77501968 CTGCTTTGCATGAAGCAAAGAGG - Intergenic
1087229018 11:95638514-95638536 CTGATATGCTTGAAGGAGAGAGG + Intergenic
1087896108 11:103588393-103588415 CTGCAGTGGTTGCATGAAAGAGG + Intergenic
1088797222 11:113274147-113274169 CTGATGTGCAGGAAGAAAAGAGG + Intronic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1089296593 11:117472600-117472622 CTCCTGTCGATGAAGGAAAGAGG - Intronic
1090242036 11:125190744-125190766 CTGCTGGGCTTGAAGGATGCAGG - Intronic
1090718049 11:129447548-129447570 CAGGTGTGCTGGAAGGCAAGGGG + Intronic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1093294992 12:17378985-17379007 CTGCTGTTCTTGTAAGAAAGAGG + Intergenic
1094284813 12:28781277-28781299 CAGCAGTGCTTGAAGGCACGGGG - Intergenic
1095045280 12:37496563-37496585 ATGCTTTCCTTGAAAGAAAGAGG - Intergenic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1101748751 12:107565240-107565262 CTGCAGGACTTGAAGGAAATGGG + Intronic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1103000450 12:117381844-117381866 CTGGTGGGCTTGAAGTAAGGAGG - Intronic
1105982545 13:25533716-25533738 CTGCTGTGCTAGAACGGAAATGG - Intronic
1107258312 13:38457809-38457831 CTGATTTCCCTGAAGGAAAGTGG - Intergenic
1107415186 13:40193450-40193472 CTCCTGAGCCTGAAAGAAAGAGG + Intergenic
1108456204 13:50616355-50616377 TTGCTGTGCTTGTTGCAAAGAGG - Intronic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1113500889 13:110773247-110773269 CTTCATGGCTTGAAGGAAAGGGG - Intergenic
1115860778 14:37683887-37683909 ATGCTGTGGTTCAAGGAAAAGGG - Intronic
1124144821 15:27114820-27114842 CTTCTGTGCTAGAATGGAAGGGG - Intronic
1125496263 15:40197377-40197399 CTGGAGTACTTGAAGGCAAGAGG + Intronic
1126289868 15:47061942-47061964 ATGCTTTGCTTGAAAGAAGGAGG + Intergenic
1126416695 15:48425200-48425222 CTCCTGTGCTGGAGGGAAGGAGG - Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1129159812 15:73740943-73740965 CTGCTGTGTTTGAGAGACAGGGG - Intronic
1131382412 15:91974731-91974753 GTGCTGTGCTGGCAGGAAGGCGG + Intronic
1132126307 15:99228351-99228373 CTGCTGTGCTTGGAGCCTAGAGG + Intronic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1133270852 16:4610219-4610241 ATGCTGTGGCTGATGGAAAGGGG - Intronic
1134394393 16:13849847-13849869 CTGCCGTGGTTGCAGGATAGGGG - Intergenic
1134451596 16:14367381-14367403 CTGTTGTCCTTGGAGGCAAGGGG - Intergenic
1136996598 16:35195122-35195144 CGGTTGTGCTTGAAGGGGAGAGG - Intergenic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137711965 16:50572802-50572824 CTCCTGGGCTTGAAAGAAACTGG - Intronic
1137943338 16:52710174-52710196 CAGCTGTGCTGGGAGTAAAGTGG + Intergenic
1138107078 16:54293331-54293353 CTGGTTTGACTGAAGGAAAGGGG + Intergenic
1138933754 16:61694259-61694281 GTGCTTTTCTAGAAGGAAAGTGG + Intronic
1139749392 16:69100012-69100034 CTGCTCTGCTGGAGGCAAAGCGG - Intergenic
1139933360 16:70548098-70548120 ATATTGTACTTGAAGGAAAGGGG + Intronic
1140148183 16:72332862-72332884 CTGCTGTGCTGGAGGGACTGAGG + Intergenic
1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG + Intergenic
1141450384 16:84095906-84095928 CCACTCTGTTTGAAGGAAAGTGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144188857 17:12824600-12824622 CTACTGTGTTAGAAGCAAAGTGG - Intronic
1144379952 17:14684930-14684952 GTGTTGTGCTTGAAGGAAATGGG - Intergenic
1144734589 17:17548024-17548046 CTGCTGTGCGTGCAGCAGAGTGG - Intronic
1144995282 17:19263877-19263899 CTGTGGTGGCTGAAGGAAAGAGG + Intronic
1146055626 17:29579388-29579410 CTGCAGTGCCTTAAGGCAAGGGG - Intronic
1146964485 17:37013470-37013492 CTTCTGTTCATGAAGGAAGGCGG + Intronic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1147907824 17:43834046-43834068 CTGCTGGGATTGAGGGAAGGGGG - Intergenic
1149840908 17:59964420-59964442 TGTCTGTGCATGAAGGAAAGTGG - Intronic
1150356170 17:64486730-64486752 ATGGTGTGCTTTAGGGAAAGGGG + Intronic
1150595064 17:66596488-66596510 CTTCAGTGCATGATGGAAAGGGG + Intronic
1150667334 17:67153675-67153697 TTGCTGTGGGTGAAGGGAAGTGG - Intronic
1150836294 17:68567218-68567240 CTGCTGTTATTGCACGAAAGGGG + Intronic
1151109934 17:71664267-71664289 CAGCAGGGATTGAAGGAAAGGGG - Intergenic
1152572956 17:81128489-81128511 CTCCTGTACCTGAAGGAAATCGG - Exonic
1152975880 18:217869-217891 CTGCTGTGGTTAAAGCAGAGGGG + Intronic
1155259297 18:24025873-24025895 CAGCTGTGGCTGAAGGAGAGAGG + Intronic
1158876931 18:61742969-61742991 ATGCTGTGTCTGAAGGAAGGTGG + Intergenic
1160217604 18:76946505-76946527 CTCCTGTGCTTTAAGGTGAGGGG - Intronic
1162928365 19:13942215-13942237 CAGCTGTGCCTGAAGGATACAGG - Intronic
1162939139 19:13997600-13997622 CTGCTGAGGATGAAGGAAACAGG + Intronic
1164903814 19:31950433-31950455 CTCCTGAGCTTGAAGGAATTTGG + Intergenic
1165139326 19:33689471-33689493 GTGCTGGGCTTGGGGGAAAGGGG + Intronic
1165437476 19:35804113-35804135 ATGCTGTAGTTGAAGGAGAGGGG - Intronic
1165742903 19:38214095-38214117 CTGCTGTGGGTAATGGAAAGTGG - Intronic
1167095004 19:47370572-47370594 CTGCTGTGCTGCAAGGATGGGGG - Intronic
1167527505 19:49994181-49994203 CTGCTGTGATTGAGAGTAAGAGG - Intronic
1202702904 1_KI270713v1_random:1757-1779 CTGCAGGGCTTTAAGGAGAGAGG + Intergenic
925234245 2:2264128-2264150 ATGCTGTGCTGGAAGGAACTTGG - Intronic
925270883 2:2606589-2606611 CTGCTGTGCAGGAAGCATAGGGG - Intergenic
925390977 2:3493801-3493823 GTGCTGGGCTGGAAGGAGAGCGG + Intergenic
925912551 2:8583119-8583141 TTGCTGTCCTGGAAGGAAAGGGG - Intergenic
926398590 2:12471135-12471157 GTGCTGTGCTTTGAAGAAAGAGG + Intergenic
926830135 2:16952728-16952750 ATGCTGTGTTAGAAGGTAAGAGG + Intergenic
927834139 2:26378348-26378370 ATGCTGTGCTTGAAAGACAGAGG - Intronic
928318603 2:30265627-30265649 CTTCTATGCTAGAAGGAAATGGG + Intronic
929033351 2:37669560-37669582 CTGCTCAGATTGAGGGAAAGAGG + Intronic
930942946 2:57035672-57035694 CAGCAGTGCTTGAGGTAAAGGGG - Intergenic
931236656 2:60418328-60418350 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
931304875 2:61018099-61018121 TCTCTGTGCTTGAAAGAAAGGGG + Exonic
931617498 2:64174929-64174951 CTGATGTGCATGGAGGCAAGAGG - Intergenic
933771665 2:85748547-85748569 CTGCTGTGCTTTATGGAGACTGG - Intergenic
935664954 2:105503027-105503049 GGGCTGTGCTTGCAGGAGAGAGG + Intergenic
935936134 2:108185101-108185123 CTGCTGTCCATGAAGGAAGGAGG - Intergenic
936267882 2:111024068-111024090 CTGCTGTGGTTTAACTAAAGAGG + Intronic
936938181 2:117858556-117858578 CAGCCGTGCTGGAAGCAAAGCGG + Intergenic
937934405 2:127230999-127231021 CAGCTGTGCCTGCAGGAAATTGG + Intergenic
938448684 2:131397338-131397360 CTGCAGAGCTTGAAGGTCAGAGG + Intergenic
938972976 2:136449084-136449106 CTGCTGTTATTGAAGGCAAGTGG + Intergenic
939756167 2:146115130-146115152 CTGCTGGGATGGAAGTAAAGAGG + Intergenic
940365041 2:152838866-152838888 CTGCAGTGCTTGAAAAACAGTGG + Intergenic
944758733 2:202791100-202791122 CTGCTTTGCCTGAAGGAACCAGG + Intronic
945665260 2:212733630-212733652 CTGCTGTGCTTGCAGAAATTTGG + Intergenic
946321175 2:218955406-218955428 CTGCTTTCCTTGATGGAAGGGGG - Intergenic
946487581 2:220115507-220115529 GTGCTCTGCTTGAAGGGCAGAGG - Intergenic
946518292 2:220437393-220437415 TTTATGTACTTGAAGGAAAGAGG + Intergenic
947989064 2:234472866-234472888 CTGCTCTTCTTGTAGGACAGAGG + Intergenic
948710113 2:239820070-239820092 CAGATGTGCTTGGAGGAGAGGGG + Intergenic
1170886295 20:20342762-20342784 TTGCTGTGATTTAAGGAGAGTGG + Intronic
1171090449 20:22280607-22280629 CTGCTGTTGTTGTGGGAAAGTGG - Intergenic
1171866103 20:30488438-30488460 CTGCAGTGCGTGCAGGGAAGAGG - Intergenic
1173450852 20:43162693-43162715 CTGGTGTGGCTGAAGGGAAGGGG - Intronic
1175467267 20:59197803-59197825 GTGCTGCTCTTGGAGGAAAGGGG + Intronic
1175568277 20:59998275-59998297 CTGCTGAGCTTGGAGGAGACTGG + Intronic
1176212623 20:63932443-63932465 CAGGTGTGCTGGAAGGAATGTGG - Exonic
1177262875 21:18752061-18752083 CTATTGTGCTCGATGGAAAGAGG - Intergenic
1178191670 21:30289246-30289268 CTGCTGTGCATGAAGGAAATAGG + Exonic
1178347813 21:31846917-31846939 CTGCTCTGGTTGAAGGAGTGAGG - Intergenic
1178420996 21:32443054-32443076 CTGCTGAGCCTGGAGGAAAAGGG - Intronic
1179460365 21:41530702-41530724 CTGCTGTCAGTGAGGGAAAGGGG + Intronic
1182846785 22:33437972-33437994 CTGCAGTGCTGGAAGGGATGTGG - Intronic
1184075736 22:42176361-42176383 CTGCTGCGCTGGAAGGAAGGGGG + Intronic
1184453863 22:44598189-44598211 ATGCAGTGATTGAGGGAAAGAGG + Intergenic
1184915661 22:47567302-47567324 CTGGTGCGCTAGAAGGAGAGGGG - Intergenic
1184972491 22:48036212-48036234 CTGGTGAGCTGGGAGGAAAGCGG + Intergenic
949845811 3:8369602-8369624 CTACTCTGGTTGAAGGGAAGAGG + Intergenic
950642224 3:14355779-14355801 CTTCTGCCCTTGAAAGAAAGTGG + Intergenic
950896425 3:16455647-16455669 CTGCTGTGTTCAAAGGACAGTGG + Intronic
952827441 3:37536139-37536161 CTGCTGAGCTTGGATGGAAGTGG - Intronic
953392401 3:42541069-42541091 CTGCTGTGCTGGCAGGAGTGGGG + Intergenic
956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG + Intronic
959269594 3:104190772-104190794 CTGCTGTGGATGAAGGAAGTTGG + Intergenic
960824369 3:121767547-121767569 CTCCTGGGCTTGGAGGAAACAGG + Intergenic
961453516 3:127013296-127013318 CAGCTGTGTTTAAAGGGAAGCGG + Intronic
961465877 3:127081335-127081357 CAGGTGTGATGGAAGGAAAGTGG - Intergenic
961981319 3:131082052-131082074 CTGCTTTGCTTGGAGGAAAGTGG + Intronic
962287956 3:134104279-134104301 GTTCTGTGCTTGGAGGAATGTGG + Intronic
962420378 3:135223319-135223341 CTGCTGTGGTTGAAGCAAGGTGG - Intronic
962531627 3:136286684-136286706 ATGATGTGCTTGAATCAAAGTGG - Intronic
962752056 3:138440780-138440802 CTGTTGGGCTTGGAGGAAAGAGG - Intronic
963384304 3:144571273-144571295 ATGCTTGACTTGAAGGAAAGAGG + Intergenic
965450745 3:168834671-168834693 CTCCTTTGGTTGAAGGCAAGAGG + Intergenic
966838509 3:184068499-184068521 CTGCTGTGCTTGCGGGCAGGAGG - Intergenic
967817891 3:193814696-193814718 CTGATTTGCTTCAGGGAAAGGGG + Intergenic
971924304 4:32987036-32987058 CTGATGAGATTGAAGGAAAGAGG - Intergenic
971995159 4:33955476-33955498 CTGCTGGGCTTGGAGGGAACGGG - Intergenic
972156020 4:36162864-36162886 TTGGTGGGTTTGAAGGAAAGAGG + Intronic
973134421 4:46689026-46689048 CTCCTAGGCTTGAAGGGAAGAGG + Intergenic
973605361 4:52581684-52581706 CTGCACTTCTTGAAGGACAGAGG - Intergenic
977724538 4:100280166-100280188 CTGCTCAGATTGAAGGAGAGTGG + Intergenic
977970480 4:103207692-103207714 CTACTGTGCTAGGAAGAAAGAGG - Intergenic
979602757 4:122604388-122604410 CAGCTGTGCTTGGAGGCAAAGGG - Intergenic
979727755 4:123984682-123984704 CAGCTTTGCTAGAAAGAAAGAGG + Intergenic
979727793 4:123985116-123985138 CTGCTGTGTTTGAAGGGGAGTGG - Intergenic
980984766 4:139684681-139684703 CTTCAGGGGTTGAAGGAAAGAGG + Intronic
982082718 4:151806202-151806224 AAGCTGTGCTTGCAGGAGAGGGG + Intergenic
982313417 4:154008526-154008548 CTGCTGTGCCTGCAGGCCAGCGG - Intergenic
983045762 4:162984814-162984836 CTGCTGTGGTTGCAGGAGCGTGG - Intergenic
983421350 4:167521692-167521714 CTCCTGTGCTATAAGGAAAGTGG + Intergenic
984757718 4:183339528-183339550 CTGCTGTGCTTGGAGAACAGAGG - Intergenic
985682737 5:1265041-1265063 CTGCTGTGCTTTAGACAAAGGGG + Intronic
986521962 5:8628922-8628944 CTGCTGACCCTGAAGGCAAGGGG + Intergenic
986932233 5:12840402-12840424 CAGCTGTGCTTGAATTAAACAGG - Intergenic
987002854 5:13678139-13678161 CTGCTGTCCCTGAAAGAAACTGG + Intergenic
988631725 5:32938522-32938544 CTGCTGTCCTAGAAGGAGATGGG + Intergenic
989403894 5:41039135-41039157 CTGCTTTCCCTGAAGGAAAGGGG - Intronic
989618132 5:43357664-43357686 CTGATGTTCCTGAAAGAAAGGGG + Intergenic
990200530 5:53367584-53367606 CTTTTGTGCCTCAAGGAAAGTGG - Intergenic
990445370 5:55888905-55888927 CTCCTGTGCTTTAAGGAAATTGG - Intronic
991609600 5:68436592-68436614 CTGCTATGTTTGTAGGAAGGAGG - Intergenic
993134868 5:83947292-83947314 CTGCTGTTCTTAAGGGATAGAGG + Intronic
993765795 5:91856767-91856789 CTGCTGTGCTTGCAGGAAGGGGG + Intergenic
995697570 5:114897723-114897745 ATTCTGTGCCTGAAAGAAAGAGG - Intergenic
996451481 5:123630263-123630285 CTGGTGTGCCTGAAAGAAATGGG + Intergenic
996988680 5:129601484-129601506 TTGCTGTGCTTTGAGGGAAGAGG + Intronic
997524834 5:134545620-134545642 TTGCTGTGGTTAAAGGACAGTGG + Intronic
997580754 5:135015338-135015360 CTGCAGAGCTAGAGGGAAAGGGG + Intergenic
997735173 5:136207926-136207948 CTTCTGTGGTTGAAGGAGCGAGG - Intergenic
998086136 5:139325218-139325240 CTGCTTTACTTGAAGGGAAACGG - Intronic
998215215 5:140233113-140233135 TTGCTGTGGTTGAGGCAAAGAGG + Intronic
998674336 5:144390329-144390351 GTGATGTGTTTGAAGGAAAGGGG + Intronic
998862857 5:146461569-146461591 ATGCTGTGCTGGAAAGTAAGAGG + Intronic
999073014 5:148767736-148767758 CAGATGTGCTTTAAGGAAAGAGG + Intergenic
1006370642 6:33641686-33641708 CTGGTGTGGTTGCAGGGAAGTGG - Intronic
1006561286 6:34914928-34914950 CTGCTGTGCTTAAGAGAACGTGG + Intronic
1007624822 6:43239363-43239385 TTGGAGTCCTTGAAGGAAAGGGG + Intergenic
1007784052 6:44270402-44270424 CGGCTGCGCTGGCAGGAAAGGGG + Intergenic
1007817603 6:44535546-44535568 CTGCTGTAGCTGAAGGAAATGGG + Intergenic
1008509250 6:52260911-52260933 CTGCTGTACATGTAGGGAAGTGG - Intergenic
1009235065 6:61113256-61113278 CTACTGAGTCTGAAGGAAAGTGG + Intergenic
1009694841 6:67088985-67089007 CTGCTGTGATGGAAGGAATGAGG + Intergenic
1011117437 6:83909076-83909098 CTGCTGTTCTGAAAGGTAAGTGG + Exonic
1011823861 6:91283586-91283608 CTGTTGAGTTTGAAGGAAAGAGG + Intergenic
1012586794 6:100933072-100933094 CTGCTGTGCTGGAGGGACTGAGG + Intergenic
1013607236 6:111761690-111761712 CTTCAGTGCTTGAAGCCAAGTGG - Intronic
1013655008 6:112237520-112237542 CTGCTGTGATTGAAGGAGGTAGG + Intronic
1013733438 6:113198406-113198428 CTGCGGTTCAGGAAGGAAAGAGG - Intergenic
1015000679 6:128210598-128210620 CTGCTGTGGATCAAGGAAGGAGG + Intronic
1016231581 6:141812008-141812030 CTTCTGTGATTGAAGCAGAGGGG + Intergenic
1016903154 6:149121711-149121733 CTGCGGTGTTTGTAGGAGAGTGG - Intergenic
1018411573 6:163554151-163554173 CTGGTGTGCATGGAGGGAAGGGG + Intronic
1018972987 6:168541391-168541413 CGGCTGTACTTGCAGAAAAGGGG - Intronic
1019089204 6:169511893-169511915 CTGCTTTCCTAAAAGGAAAGTGG + Intronic
1019620725 7:1990647-1990669 CAGCTGTGCTTGGAGGAACCGGG + Intronic
1019632338 7:2056412-2056434 CTGCTCTGCTCTAGGGAAAGAGG + Intronic
1019714576 7:2532589-2532611 CTGCTTTGCTGGAAGGCAAGAGG + Intergenic
1019741744 7:2678464-2678486 CTGCTTTGCTGGAAGGCAAGAGG - Intergenic
1022444120 7:30455931-30455953 CTGCTGTGCAGGAATGAGAGTGG + Intronic
1023674911 7:42618834-42618856 CTGCTGTGCTTGAGTGCAGGAGG + Intergenic
1024321688 7:48077516-48077538 TTGCTGTGCTTGAAGGATGGGGG - Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1025603882 7:63024904-63024926 GTGTTGCGCTGGAAGGAAAGAGG - Intergenic
1026222386 7:68411825-68411847 CAGCTGTACTAGTAGGAAAGGGG + Intergenic
1028734252 7:94189410-94189432 CTGCTATGCTAGAAGGACCGAGG + Intergenic
1029419291 7:100464140-100464162 CTGCTGTGCTTGAAGCTCACAGG - Exonic
1030109048 7:106010831-106010853 CTGATCTGAGTGAAGGAAAGAGG + Intronic
1030944767 7:115704403-115704425 CTGGCATGCTTGAAGGATAGTGG - Intergenic
1031012606 7:116539318-116539340 TTGCTCTGCTTGAAGGATACAGG - Intronic
1031015569 7:116572584-116572606 CTTGTGTGTTTGAGGGAAAGTGG - Intergenic
1031216307 7:118897370-118897392 GTACTGTGCTTGCAGGAAAGTGG + Intergenic
1031421589 7:121558412-121558434 ATGCTGTGCCTGAAAGAAAGGGG - Intergenic
1031958019 7:127962184-127962206 TTGCTGTGCTGGAAGGAAGATGG + Intronic
1033032430 7:137840292-137840314 CAGATGAGCTGGAAGGAAAGAGG + Intronic
1034099047 7:148436084-148436106 CTGGTGTGCTTGCAGGAACCTGG - Intergenic
1034538445 7:151740377-151740399 CTGCTGTGCCTGAAGGATGAAGG - Intronic
1034677858 7:152904443-152904465 TGGCGGTGGTTGAAGGAAAGAGG + Intergenic
1035006099 7:155662330-155662352 CTGCTGTGCTGGAGAGAAATGGG - Intronic
1036967359 8:13315602-13315624 CTCCTGTGATTTAAGGAGAGAGG - Intronic
1038453138 8:27652600-27652622 CTTCTTAGCTTGAAGGCAAGAGG + Intronic
1038818892 8:30934099-30934121 CTTCTGTGCTTATAGGAGAGAGG - Intergenic
1043556256 8:81433666-81433688 CTGCTGTTCTTGCAGGAGTGAGG + Intergenic
1045747873 8:105445192-105445214 CTGCTGTACGTGAAGAAGAGAGG + Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047388258 8:124429446-124429468 CTGCTGCACTTGGAGGAAATAGG - Intergenic
1048343093 8:133555694-133555716 CTCCTGTGATTGGAGGGAAGAGG - Intronic
1049748977 8:144274693-144274715 CTGCTGTGCTGGGAGGAAGCCGG - Intronic
1050112750 9:2233691-2233713 CTGTTGTGATTCAAGGAGAGGGG + Intergenic
1050528000 9:6562964-6562986 GTGCTGTGCTTCAGGGAGAGGGG - Intronic
1052118411 9:24677429-24677451 GTGCTGTGCTTGAAGGACTATGG - Intergenic
1052404582 9:28043445-28043467 CTGCAGTGGTTGAAGGTGAGGGG + Intronic
1052733622 9:32318251-32318273 CTACTGTGCCTCCAGGAAAGGGG + Intergenic
1055325397 9:75123086-75123108 TTGCTGTTCTTCAAGGAGAGAGG + Intronic
1057353695 9:94319213-94319235 CTCCTGTCCTTGAAGGAGAAAGG - Exonic
1057654055 9:96938379-96938401 CTCCTGTCCTTGAAGGAGAAAGG + Exonic
1059113844 9:111583064-111583086 CTGTTGTACTAGAAGGAAATGGG - Intronic
1059867292 9:118529757-118529779 CTGCTCTGGTAGAAGGAAGGTGG + Intergenic
1060012036 9:120052301-120052323 AGGCTGTGCTTGAAGGAGGGTGG + Intergenic
1062460454 9:136660607-136660629 CTGCTGTGCTTACAGGCAAGGGG - Intronic
1187036852 X:15549592-15549614 CATCTGTGCTTGCTGGAAAGTGG - Intronic
1189958644 X:46304064-46304086 CTGCTGTGATGGAAGTAAAATGG + Intergenic
1190111173 X:47590032-47590054 CTGCTCTGCCTGAAGGAATGGGG + Intronic
1190398938 X:50012346-50012368 CACCAGAGCTTGAAGGAAAGTGG + Intronic
1191729008 X:64314140-64314162 CTGCTGTGCTAGAAGGGCCGAGG + Intronic
1192097960 X:68233244-68233266 CTGAGGTGCTTGAAGGTAATAGG - Intronic
1192215611 X:69156214-69156236 GTGCTCTGCTTGGAGGCAAGTGG + Intergenic
1192863597 X:75106842-75106864 TTGGTGTCCTTGAAGGGAAGGGG - Intronic
1194128256 X:90046659-90046681 CTGCAGTGCTTGGTAGAAAGGGG + Intergenic
1194821326 X:98510391-98510413 CTACTGTGCCTGATGGAAACAGG - Intergenic
1194908264 X:99606008-99606030 CTGCTTTGCTTGTAAGAAATTGG - Intergenic
1195053271 X:101117933-101117955 TTGCTGAGCTGGCAGGAAAGCGG + Intronic
1195421772 X:104683493-104683515 CTGCTGTGGTTGAAGTGGAGTGG - Intronic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1199567874 X:149234875-149234897 CTGCTGTGTTTGAATCCAAGTGG + Intergenic
1201077141 Y:10196769-10196791 CTGCGGCGCGTGCAGGAAAGAGG + Intergenic
1201688915 Y:16740744-16740766 ATGTTGTGCTTGGAGAAAAGAGG - Intergenic