ID: 914286977

View in Genome Browser
Species Human (GRCh38)
Location 1:146236204-146236226
Sequence ACTGAGATCCAGACTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914286977_914286978 -5 Left 914286977 1:146236204-146236226 CCTGGCACAGTCTGGATCTCAGT No data
Right 914286978 1:146236222-146236244 TCAGTCCCTGACTCAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914286977 Original CRISPR ACTGAGATCCAGACTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr