ID: 914291183

View in Genome Browser
Species Human (GRCh38)
Location 1:146275018-146275040
Sequence ATGTATTAGCTGACTAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914291183_914291184 8 Left 914291183 1:146275018-146275040 CCTTATTTAGTCAGCTAATACAT No data
Right 914291184 1:146275049-146275071 CACTCTGATATTGTAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914291183 Original CRISPR ATGTATTAGCTGACTAAATA AGG (reversed) Intergenic
No off target data available for this crispr