ID: 914295971

View in Genome Browser
Species Human (GRCh38)
Location 1:146325406-146325428
Sequence GGCCATCAAAGTACTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914295969_914295971 -10 Left 914295969 1:146325393-146325415 CCATTTCTTTCATGGCCATCAAA No data
Right 914295971 1:146325406-146325428 GGCCATCAAAGTACTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914295971 Original CRISPR GGCCATCAAAGTACTGAGGT AGG Intergenic
No off target data available for this crispr