ID: 914296144

View in Genome Browser
Species Human (GRCh38)
Location 1:146326994-146327016
Sequence CTAGGCCTGAATGTATAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914296144_914296153 11 Left 914296144 1:146326994-146327016 CCCCCTTATACATTCAGGCCTAG No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data
914296144_914296152 4 Left 914296144 1:146326994-146327016 CCCCCTTATACATTCAGGCCTAG No data
Right 914296152 1:146327021-146327043 GGTAACAACCAGTATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914296144 Original CRISPR CTAGGCCTGAATGTATAAGG GGG (reversed) Intergenic
No off target data available for this crispr