ID: 914296145

View in Genome Browser
Species Human (GRCh38)
Location 1:146326995-146327017
Sequence CCTAGGCCTGAATGTATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914296145_914296152 3 Left 914296145 1:146326995-146327017 CCCCTTATACATTCAGGCCTAGG No data
Right 914296152 1:146327021-146327043 GGTAACAACCAGTATGCTACTGG No data
914296145_914296153 10 Left 914296145 1:146326995-146327017 CCCCTTATACATTCAGGCCTAGG No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914296145 Original CRISPR CCTAGGCCTGAATGTATAAG GGG (reversed) Intergenic
No off target data available for this crispr