ID: 914296149

View in Genome Browser
Species Human (GRCh38)
Location 1:146326997-146327019
Sequence TCCCTAGGCCTGAATGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914296149_914296153 8 Left 914296149 1:146326997-146327019 CCTTATACATTCAGGCCTAGGGA No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data
914296149_914296152 1 Left 914296149 1:146326997-146327019 CCTTATACATTCAGGCCTAGGGA No data
Right 914296152 1:146327021-146327043 GGTAACAACCAGTATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914296149 Original CRISPR TCCCTAGGCCTGAATGTATA AGG (reversed) Intergenic
No off target data available for this crispr