ID: 914296151

View in Genome Browser
Species Human (GRCh38)
Location 1:146327012-146327034
Sequence TACTGGTTGTTACCATCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914296151_914296153 -7 Left 914296151 1:146327012-146327034 CCTAGGGATGGTAACAACCAGTA No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914296151 Original CRISPR TACTGGTTGTTACCATCCCT AGG (reversed) Intergenic
No off target data available for this crispr