ID: 914296153

View in Genome Browser
Species Human (GRCh38)
Location 1:146327028-146327050
Sequence ACCAGTATGCTACTGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914296145_914296153 10 Left 914296145 1:146326995-146327017 CCCCTTATACATTCAGGCCTAGG No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data
914296143_914296153 14 Left 914296143 1:146326991-146327013 CCTCCCCCTTATACATTCAGGCC No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data
914296144_914296153 11 Left 914296144 1:146326994-146327016 CCCCCTTATACATTCAGGCCTAG No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data
914296149_914296153 8 Left 914296149 1:146326997-146327019 CCTTATACATTCAGGCCTAGGGA No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data
914296151_914296153 -7 Left 914296151 1:146327012-146327034 CCTAGGGATGGTAACAACCAGTA No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data
914296147_914296153 9 Left 914296147 1:146326996-146327018 CCCTTATACATTCAGGCCTAGGG No data
Right 914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914296153 Original CRISPR ACCAGTATGCTACTGGTCAG AGG Intergenic
No off target data available for this crispr