ID: 914301494

View in Genome Browser
Species Human (GRCh38)
Location 1:146381447-146381469
Sequence GGCCGCAGGGACCTCTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914301486_914301494 22 Left 914301486 1:146381402-146381424 CCACTCCCTAATCTCAAGTACCC 0: 2088
1: 498
2: 162
3: 314
4: 1246
Right 914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG No data
914301488_914301494 16 Left 914301488 1:146381408-146381430 CCTAATCTCAAGTACCCAGAGAC 0: 56
1: 2074
2: 455
3: 370
4: 188
Right 914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG No data
914301490_914301494 1 Left 914301490 1:146381423-146381445 CCAGAGACACAATACACTGCAGA 0: 5
1: 24
2: 79
3: 194
4: 374
Right 914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG No data
914301489_914301494 2 Left 914301489 1:146381422-146381444 CCCAGAGACACAATACACTGCAG 0: 5
1: 24
2: 67
3: 112
4: 233
Right 914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG No data
914301487_914301494 17 Left 914301487 1:146381407-146381429 CCCTAATCTCAAGTACCCAGAGA 0: 55
1: 2083
2: 455
3: 361
4: 196
Right 914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914301494 Original CRISPR GGCCGCAGGGACCTCTGCCA AGG Intergenic
No off target data available for this crispr