ID: 914303585

View in Genome Browser
Species Human (GRCh38)
Location 1:146396763-146396785
Sequence GTCAGATGGATTAATTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914303585_914303591 16 Left 914303585 1:146396763-146396785 CCATAAAAATTAATCCATCTGAC No data
Right 914303591 1:146396802-146396824 AACAGAATCCTGCACCTAACAGG No data
914303585_914303592 23 Left 914303585 1:146396763-146396785 CCATAAAAATTAATCCATCTGAC No data
Right 914303592 1:146396809-146396831 TCCTGCACCTAACAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914303585 Original CRISPR GTCAGATGGATTAATTTTTA TGG (reversed) Intergenic
No off target data available for this crispr