ID: 914303588

View in Genome Browser
Species Human (GRCh38)
Location 1:146396787-146396809
Sequence ATTCTGTTGGCTCCAATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914303588_914303599 27 Left 914303588 1:146396787-146396809 CCCATCATTGGAGCCAACAGAAT No data
Right 914303599 1:146396837-146396859 ACCTGGATCCTTAGAGCCACTGG No data
914303588_914303595 10 Left 914303588 1:146396787-146396809 CCCATCATTGGAGCCAACAGAAT No data
Right 914303595 1:146396820-146396842 ACAGGCCCCTGGTGCAGACCTGG No data
914303588_914303592 -1 Left 914303588 1:146396787-146396809 CCCATCATTGGAGCCAACAGAAT No data
Right 914303592 1:146396809-146396831 TCCTGCACCTAACAGGCCCCTGG No data
914303588_914303591 -8 Left 914303588 1:146396787-146396809 CCCATCATTGGAGCCAACAGAAT No data
Right 914303591 1:146396802-146396824 AACAGAATCCTGCACCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914303588 Original CRISPR ATTCTGTTGGCTCCAATGAT GGG (reversed) Intergenic
No off target data available for this crispr