ID: 914303591

View in Genome Browser
Species Human (GRCh38)
Location 1:146396802-146396824
Sequence AACAGAATCCTGCACCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914303585_914303591 16 Left 914303585 1:146396763-146396785 CCATAAAAATTAATCCATCTGAC No data
Right 914303591 1:146396802-146396824 AACAGAATCCTGCACCTAACAGG No data
914303587_914303591 2 Left 914303587 1:146396777-146396799 CCATCTGACACCCATCATTGGAG No data
Right 914303591 1:146396802-146396824 AACAGAATCCTGCACCTAACAGG No data
914303589_914303591 -9 Left 914303589 1:146396788-146396810 CCATCATTGGAGCCAACAGAATC No data
Right 914303591 1:146396802-146396824 AACAGAATCCTGCACCTAACAGG No data
914303588_914303591 -8 Left 914303588 1:146396787-146396809 CCCATCATTGGAGCCAACAGAAT No data
Right 914303591 1:146396802-146396824 AACAGAATCCTGCACCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914303591 Original CRISPR AACAGAATCCTGCACCTAAC AGG Intergenic
No off target data available for this crispr