ID: 914306589

View in Genome Browser
Species Human (GRCh38)
Location 1:146425338-146425360
Sequence GGGTGCTATTATTCACCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914306589_914306596 21 Left 914306589 1:146425338-146425360 CCACAAGGTGAATAATAGCACCC No data
Right 914306596 1:146425382-146425404 AGATAAGGACTTAATCTATCAGG No data
914306589_914306593 6 Left 914306589 1:146425338-146425360 CCACAAGGTGAATAATAGCACCC No data
Right 914306593 1:146425367-146425389 GAAGGTCCACCATGAAGATAAGG No data
914306589_914306597 25 Left 914306589 1:146425338-146425360 CCACAAGGTGAATAATAGCACCC No data
Right 914306597 1:146425386-146425408 AAGGACTTAATCTATCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914306589 Original CRISPR GGGTGCTATTATTCACCTTG TGG (reversed) Intergenic
No off target data available for this crispr