ID: 914306593

View in Genome Browser
Species Human (GRCh38)
Location 1:146425367-146425389
Sequence GAAGGTCCACCATGAAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914306587_914306593 14 Left 914306587 1:146425330-146425352 CCCAGAAACCACAAGGTGAATAA No data
Right 914306593 1:146425367-146425389 GAAGGTCCACCATGAAGATAAGG No data
914306585_914306593 23 Left 914306585 1:146425321-146425343 CCAAGACAGCCCAGAAACCACAA No data
Right 914306593 1:146425367-146425389 GAAGGTCCACCATGAAGATAAGG No data
914306588_914306593 13 Left 914306588 1:146425331-146425353 CCAGAAACCACAAGGTGAATAAT No data
Right 914306593 1:146425367-146425389 GAAGGTCCACCATGAAGATAAGG No data
914306589_914306593 6 Left 914306589 1:146425338-146425360 CCACAAGGTGAATAATAGCACCC No data
Right 914306593 1:146425367-146425389 GAAGGTCCACCATGAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914306593 Original CRISPR GAAGGTCCACCATGAAGATA AGG Intergenic
No off target data available for this crispr