ID: 914306596

View in Genome Browser
Species Human (GRCh38)
Location 1:146425382-146425404
Sequence AGATAAGGACTTAATCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914306589_914306596 21 Left 914306589 1:146425338-146425360 CCACAAGGTGAATAATAGCACCC No data
Right 914306596 1:146425382-146425404 AGATAAGGACTTAATCTATCAGG No data
914306591_914306596 1 Left 914306591 1:146425358-146425380 CCCAGAACAGAAGGTCCACCATG No data
Right 914306596 1:146425382-146425404 AGATAAGGACTTAATCTATCAGG No data
914306588_914306596 28 Left 914306588 1:146425331-146425353 CCAGAAACCACAAGGTGAATAAT No data
Right 914306596 1:146425382-146425404 AGATAAGGACTTAATCTATCAGG No data
914306587_914306596 29 Left 914306587 1:146425330-146425352 CCCAGAAACCACAAGGTGAATAA No data
Right 914306596 1:146425382-146425404 AGATAAGGACTTAATCTATCAGG No data
914306592_914306596 0 Left 914306592 1:146425359-146425381 CCAGAACAGAAGGTCCACCATGA No data
Right 914306596 1:146425382-146425404 AGATAAGGACTTAATCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914306596 Original CRISPR AGATAAGGACTTAATCTATC AGG Intergenic
No off target data available for this crispr