ID: 914306597

View in Genome Browser
Species Human (GRCh38)
Location 1:146425386-146425408
Sequence AAGGACTTAATCTATCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914306592_914306597 4 Left 914306592 1:146425359-146425381 CCAGAACAGAAGGTCCACCATGA No data
Right 914306597 1:146425386-146425408 AAGGACTTAATCTATCAGGAAGG No data
914306591_914306597 5 Left 914306591 1:146425358-146425380 CCCAGAACAGAAGGTCCACCATG No data
Right 914306597 1:146425386-146425408 AAGGACTTAATCTATCAGGAAGG No data
914306594_914306597 -10 Left 914306594 1:146425373-146425395 CCACCATGAAGATAAGGACTTAA No data
Right 914306597 1:146425386-146425408 AAGGACTTAATCTATCAGGAAGG No data
914306589_914306597 25 Left 914306589 1:146425338-146425360 CCACAAGGTGAATAATAGCACCC No data
Right 914306597 1:146425386-146425408 AAGGACTTAATCTATCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914306597 Original CRISPR AAGGACTTAATCTATCAGGA AGG Intergenic
No off target data available for this crispr