ID: 914308111

View in Genome Browser
Species Human (GRCh38)
Location 1:146441443-146441465
Sequence TTCCATGTTTTTGTTTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914308111_914308113 17 Left 914308111 1:146441443-146441465 CCTATGGAAACAAAAACATGGAA No data
Right 914308113 1:146441483-146441505 ATAACTTCTCTGTAGTCCTGAGG No data
914308111_914308115 21 Left 914308111 1:146441443-146441465 CCTATGGAAACAAAAACATGGAA No data
Right 914308115 1:146441487-146441509 CTTCTCTGTAGTCCTGAGGGTGG No data
914308111_914308114 18 Left 914308111 1:146441443-146441465 CCTATGGAAACAAAAACATGGAA No data
Right 914308114 1:146441484-146441506 TAACTTCTCTGTAGTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914308111 Original CRISPR TTCCATGTTTTTGTTTCCAT AGG (reversed) Intergenic