ID: 914308114

View in Genome Browser
Species Human (GRCh38)
Location 1:146441484-146441506
Sequence TAACTTCTCTGTAGTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914308111_914308114 18 Left 914308111 1:146441443-146441465 CCTATGGAAACAAAAACATGGAA No data
Right 914308114 1:146441484-146441506 TAACTTCTCTGTAGTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914308114 Original CRISPR TAACTTCTCTGTAGTCCTGA GGG Intergenic