ID: 914308958

View in Genome Browser
Species Human (GRCh38)
Location 1:146449024-146449046
Sequence TGTTGCCATAGCAATTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914308958_914308965 -4 Left 914308958 1:146449024-146449046 CCCACCCAATTGCTATGGCAACA No data
Right 914308965 1:146449043-146449065 AACAGTGGAGCCGCTGAGGGAGG No data
914308958_914308963 -8 Left 914308958 1:146449024-146449046 CCCACCCAATTGCTATGGCAACA No data
Right 914308963 1:146449039-146449061 TGGCAACAGTGGAGCCGCTGAGG No data
914308958_914308966 -3 Left 914308958 1:146449024-146449046 CCCACCCAATTGCTATGGCAACA No data
Right 914308966 1:146449044-146449066 ACAGTGGAGCCGCTGAGGGAGGG No data
914308958_914308969 17 Left 914308958 1:146449024-146449046 CCCACCCAATTGCTATGGCAACA No data
Right 914308969 1:146449064-146449086 GGGGCCACTCCGTGAGAACTTGG No data
914308958_914308971 21 Left 914308958 1:146449024-146449046 CCCACCCAATTGCTATGGCAACA No data
Right 914308971 1:146449068-146449090 CCACTCCGTGAGAACTTGGCTGG No data
914308958_914308964 -7 Left 914308958 1:146449024-146449046 CCCACCCAATTGCTATGGCAACA No data
Right 914308964 1:146449040-146449062 GGCAACAGTGGAGCCGCTGAGGG No data
914308958_914308967 -2 Left 914308958 1:146449024-146449046 CCCACCCAATTGCTATGGCAACA No data
Right 914308967 1:146449045-146449067 CAGTGGAGCCGCTGAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914308958 Original CRISPR TGTTGCCATAGCAATTGGGT GGG (reversed) Intergenic
No off target data available for this crispr