ID: 914313234

View in Genome Browser
Species Human (GRCh38)
Location 1:146486176-146486198
Sequence TCCTATCCCCAGGATGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914313234_914313243 22 Left 914313234 1:146486176-146486198 CCAGGCCCATCCTGGGGATAGGA No data
Right 914313243 1:146486221-146486243 AAAATGAAAAAAATGGAAGCTGG No data
914313234_914313242 15 Left 914313234 1:146486176-146486198 CCAGGCCCATCCTGGGGATAGGA No data
Right 914313242 1:146486214-146486236 CCTATTAAAAATGAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914313234 Original CRISPR TCCTATCCCCAGGATGGGCC TGG (reversed) Intergenic
No off target data available for this crispr