ID: 914315481

View in Genome Browser
Species Human (GRCh38)
Location 1:146507591-146507613
Sequence ACACCTTCATCTAGCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914315481_914315485 4 Left 914315481 1:146507591-146507613 CCTTCAGGGCTAGATGAAGGTGT No data
Right 914315485 1:146507618-146507640 CATGCTTTTTCTTCCATGGTGGG No data
914315481_914315486 5 Left 914315481 1:146507591-146507613 CCTTCAGGGCTAGATGAAGGTGT No data
Right 914315486 1:146507619-146507641 ATGCTTTTTCTTCCATGGTGGGG No data
914315481_914315487 6 Left 914315481 1:146507591-146507613 CCTTCAGGGCTAGATGAAGGTGT No data
Right 914315487 1:146507620-146507642 TGCTTTTTCTTCCATGGTGGGGG No data
914315481_914315483 0 Left 914315481 1:146507591-146507613 CCTTCAGGGCTAGATGAAGGTGT No data
Right 914315483 1:146507614-146507636 TTGGCATGCTTTTTCTTCCATGG No data
914315481_914315488 15 Left 914315481 1:146507591-146507613 CCTTCAGGGCTAGATGAAGGTGT No data
Right 914315488 1:146507629-146507651 TTCCATGGTGGGGGCAACATTGG No data
914315481_914315484 3 Left 914315481 1:146507591-146507613 CCTTCAGGGCTAGATGAAGGTGT No data
Right 914315484 1:146507617-146507639 GCATGCTTTTTCTTCCATGGTGG No data
914315481_914315489 16 Left 914315481 1:146507591-146507613 CCTTCAGGGCTAGATGAAGGTGT No data
Right 914315489 1:146507630-146507652 TCCATGGTGGGGGCAACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914315481 Original CRISPR ACACCTTCATCTAGCCCTGA AGG (reversed) Intergenic