ID: 914317280

View in Genome Browser
Species Human (GRCh38)
Location 1:146525349-146525371
Sequence GGGGGTGTTTTGTTCAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914317280_914317286 25 Left 914317280 1:146525349-146525371 CCAGAATTGAACAAAACACCCCC No data
Right 914317286 1:146525397-146525419 ACTATCATCTCCTTCATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914317280 Original CRISPR GGGGGTGTTTTGTTCAATTC TGG (reversed) Intergenic
No off target data available for this crispr