ID: 914318116

View in Genome Browser
Species Human (GRCh38)
Location 1:146533175-146533197
Sequence GAAATTTCCCCCTTTTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914318113_914318116 13 Left 914318113 1:146533139-146533161 CCAGATGATTATAGATTTCAAAC No data
Right 914318116 1:146533175-146533197 GAAATTTCCCCCTTTTGTAGGGG No data
914318112_914318116 26 Left 914318112 1:146533126-146533148 CCTGGAAATAATGCCAGATGATT No data
Right 914318116 1:146533175-146533197 GAAATTTCCCCCTTTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914318116 Original CRISPR GAAATTTCCCCCTTTTGTAG GGG Intergenic
No off target data available for this crispr