ID: 914322711

View in Genome Browser
Species Human (GRCh38)
Location 1:146580723-146580745
Sequence AAAAGCAGCCTGGAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914322709_914322711 11 Left 914322709 1:146580689-146580711 CCATGTGAGGGGCAGAATAGATG No data
Right 914322711 1:146580723-146580745 AAAAGCAGCCTGGAAAAAACAGG No data
914322708_914322711 16 Left 914322708 1:146580684-146580706 CCTTGCCATGTGAGGGGCAGAAT No data
Right 914322711 1:146580723-146580745 AAAAGCAGCCTGGAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914322711 Original CRISPR AAAAGCAGCCTGGAAAAAAC AGG Intergenic
No off target data available for this crispr