ID: 914328928

View in Genome Browser
Species Human (GRCh38)
Location 1:146648142-146648164
Sequence GAGTGTGCCAGATGGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914328920_914328928 18 Left 914328920 1:146648101-146648123 CCACCCTAGGGCACTTGAGGAAC No data
Right 914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG No data
914328919_914328928 19 Left 914328919 1:146648100-146648122 CCCACCCTAGGGCACTTGAGGAA No data
Right 914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG No data
914328922_914328928 14 Left 914328922 1:146648105-146648127 CCTAGGGCACTTGAGGAACAGAG No data
Right 914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG No data
914328921_914328928 15 Left 914328921 1:146648104-146648126 CCCTAGGGCACTTGAGGAACAGA No data
Right 914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914328928 Original CRISPR GAGTGTGCCAGATGGGTTGA TGG Intergenic
No off target data available for this crispr