ID: 914331606

View in Genome Browser
Species Human (GRCh38)
Location 1:146676484-146676506
Sequence CCACCCTGTGAGATTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914331601_914331606 12 Left 914331601 1:146676449-146676471 CCAGACCAGGATTTTGGTGACAT No data
Right 914331606 1:146676484-146676506 CCACCCTGTGAGATTCTGCCTGG No data
914331602_914331606 7 Left 914331602 1:146676454-146676476 CCAGGATTTTGGTGACATTCCAA No data
Right 914331606 1:146676484-146676506 CCACCCTGTGAGATTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914331606 Original CRISPR CCACCCTGTGAGATTCTGCC TGG Intergenic
No off target data available for this crispr