ID: 914333166

View in Genome Browser
Species Human (GRCh38)
Location 1:146691183-146691205
Sequence CTTTCTGAGCTGAAGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914333166_914333170 -7 Left 914333166 1:146691183-146691205 CCACCCAACTTCAGCTCAGAAAG No data
Right 914333170 1:146691199-146691221 CAGAAAGATGTAAAGGATCCAGG No data
914333166_914333172 5 Left 914333166 1:146691183-146691205 CCACCCAACTTCAGCTCAGAAAG No data
Right 914333172 1:146691211-146691233 AAGGATCCAGGAAGCAAACAGGG No data
914333166_914333171 4 Left 914333166 1:146691183-146691205 CCACCCAACTTCAGCTCAGAAAG No data
Right 914333171 1:146691210-146691232 AAAGGATCCAGGAAGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914333166 Original CRISPR CTTTCTGAGCTGAAGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr